ID: 1116922315

View in Genome Browser
Species Human (GRCh38)
Location 14:50592477-50592499
Sequence CAGGGTAAACAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 643}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116922308_1116922315 17 Left 1116922308 14:50592437-50592459 CCAGCAACAAGGGCGTCATATAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG 0: 1
1: 0
2: 5
3: 49
4: 643

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116922315 Original CRISPR CAGGGTAAACAGAAGGAGGA AGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904441027 1:30530886-30530908 CATGGTAAACAGGAAAAGGATGG - Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
913653492 1:120940154-120940176 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914167605 1:145188874-145188896 AAGGGTAAAAAGAAAAAGGAGGG + Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914519183 1:148400278-148400300 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914643676 1:149634313-149634335 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918543656 1:185658612-185658634 CATGGTAGACAGAATGAGGGTGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921686790 1:218098499-218098521 CACGGTAAGCAGAAGTCGGAGGG - Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG + Intronic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1066798612 10:39156374-39156396 CAGGCTAAAAACAAGAAGGAAGG + Intergenic
1066803636 10:39219083-39219105 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1069344381 10:67450630-67450652 GAGGGTAGAGAGTAGGAGGAGGG + Intronic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070662189 10:78315001-78315023 CAGGTTGAACAGTAGAAGGAAGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1073634126 10:105179933-105179955 CAGGGTTAACAGTAAGGGGAAGG - Intronic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1079300675 11:19276387-19276409 TAGGGCAAACATAATGAGGATGG + Intergenic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1085328538 11:75627497-75627519 CTGGCCAAACAGTAGGAGGAGGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1092167606 12:6352597-6352619 CAGGGTATACAGAACTGGGATGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093017652 12:14170979-14171001 AAGGGTAAAGGGAAGGGGGAGGG + Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094863129 12:34493860-34493882 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099293588 12:80802753-80802775 CCGGCTACACAGGAGGAGGAGGG - Intronic
1099567230 12:84267755-84267777 CAAGGGAAACCAAAGGAGGAGGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1106913889 13:34490864-34490886 CCAGGTAAAGAGAAAGAGGAAGG - Intergenic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111232216 13:85358460-85358482 GAGGGTAAAAGGTAGGAGGAGGG + Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115637030 14:35299676-35299698 CAGGGTAAACAGTAGTATCATGG - Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115818399 14:37187906-37187928 GAGGGTTAACCAAAGGAGGATGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1118041566 14:61922531-61922553 GAGGGTAGAGAGTAGGAGGAGGG + Intergenic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1120396331 14:83971439-83971461 TAGGTTGAAAAGAAGGAGGAAGG + Intergenic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG + Intergenic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131693130 15:94847405-94847427 CAGGATAATCAGATGTAGGAGGG - Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG + Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1139203301 16:65001436-65001458 CAGGGTAAATAGAAGAACAAAGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141659491 16:85434353-85434375 CCGGGTATACAGGAGGCGGACGG - Intergenic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1141942485 16:87286891-87286913 CAAACTAAACACAAGGAGGAAGG + Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1143002341 17:3802559-3802581 GAGGTTCAACAGAAGTAGGATGG - Intergenic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149910971 17:60566404-60566426 AAGGGTAAACACCAGGAGGCAGG - Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1151162970 17:72181386-72181408 CAAGGTAAACGGGAAGAGGATGG - Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1152643225 17:81457769-81457791 CTGGGTAATCAGGAGGGGGAGGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG + Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG + Intergenic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1165480336 19:36059818-36059840 CAGCGTAAACACCTGGAGGAGGG + Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166547552 19:43642376-43642398 CAGGGTACCCTGAAGTAGGATGG - Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1168191216 19:54739987-54740009 CAGGGTAGACATGAGGTGGAGGG - Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
931093823 2:58917298-58917320 AAGGCTAAACACCAGGAGGATGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
933264575 2:80168508-80168530 GAAGGTGATCAGAAGGAGGAGGG - Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG + Intergenic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
939870889 2:147524620-147524642 AAGGGTAGCTAGAAGGAGGAAGG + Intergenic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG + Intergenic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944897865 2:204183920-204183942 CAGGGTAAACGCAATGATGAGGG + Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG + Intergenic
1171243252 20:23588043-23588065 CAGGGTCAAGAGAAGGACCAAGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175913964 20:62417104-62417126 CAGGATAAACTGAACCAGGAAGG - Intronic
1175956022 20:62609861-62609883 CCAGGTAAACAGAAGCTGGAAGG + Intergenic
1175971917 20:62690781-62690803 CATGGTAAACGGAATGAGGTTGG + Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG + Intronic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
950045013 3:9943834-9943856 CAGGGTAATCACAACGATGATGG + Intronic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958056179 3:88415385-88415407 CAGGGTTAAAACAATGAGGATGG + Intergenic
958466598 3:94467528-94467550 CAGGATAGAAAGAAGGATGAAGG + Intergenic
958484729 3:94690330-94690352 GAGTGTAAACTCAAGGAGGATGG + Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962353508 3:134673617-134673639 CAGGGTACACAAAAGGACAAAGG - Intronic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964554709 3:157923949-157923971 GAGGGTAGACAGTAGAAGGAGGG - Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976815053 4:89138504-89138526 CAGGGTAAAAAGACTGAGAAAGG + Intergenic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980741834 4:136960603-136960625 CATGGTAAACAGAACGGTGAGGG - Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988874037 5:35424267-35424289 CAGGGCCAAAAGAAAGAGGAAGG - Intergenic
989844540 5:46124651-46124673 CAAGGTAAAAACAAGAAGGAAGG - Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
993060499 5:83032898-83032920 CAGGGCAAACTTAAGGAGTAGGG - Intergenic
993266471 5:85732338-85732360 CAGTGTAAACAAAAGGGGCAGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
994606691 5:101976267-101976289 CAAGGTAAAGAGAAGGATAATGG + Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995701891 5:114945414-114945436 GAGGGTAGAGAGTAGGAGGAGGG - Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
998744557 5:145243372-145243394 CAGGGTTAACAGAATGAAAAGGG + Intergenic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1002713310 5:181208466-181208488 CACGGTAGCCAAAAGGAGGAAGG - Intergenic
1002778500 6:348838-348860 CTGGGTAAATATAAGGAGCAAGG + Exonic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG + Intergenic
1005525757 6:26646341-26646363 CAGGCTAAAAATAAGGAGGTGGG + Intronic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1006972517 6:38061291-38061313 AAGGGTAATCAGAAGGAAAAAGG - Intronic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1009063849 6:58432313-58432335 CAGGATAAAAAGTAGAAGGAAGG - Intergenic
1009259354 6:61464264-61464286 CAGGATAAACACTAGAAGGAAGG + Intergenic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1015255832 6:131178729-131178751 CAGGTCAAACAGAAGGAGATAGG - Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018276664 6:162139511-162139533 CAGGGTAAAGAGAATCAGCATGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023335539 7:39165234-39165256 AAGGGTTAACAGATGAAGGAGGG - Intronic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1025599644 7:62979633-62979655 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1031792578 7:126126617-126126639 TAGGGTAATCAGAAGTAAGATGG + Intergenic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033485338 7:141783594-141783616 TAAGGTCAACAGCAGGAGGAGGG + Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034572249 7:151965580-151965602 CAGCGTTAACAGTAGGAGGCTGG + Intronic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037498445 8:19462966-19462988 CAGGGTGGAGAGTAGGAGGAGGG - Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039383794 8:37112123-37112145 GAGGGTAAATGGCAGGAGGAGGG + Intergenic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039623684 8:39025400-39025422 CAGGGTGAACATGAGGAGTAAGG - Intronic
1040700898 8:50064388-50064410 CAAGGTAAGCAGAAGGAGATGGG - Intronic
1041275697 8:56155650-56155672 CAGGGTAGAGAAAAGGAGTAGGG + Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1047054313 8:121147175-121147197 TTAGGTAAACTGAAGGAGGAAGG - Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1049199866 8:141334735-141334757 CCTGGTAAACAGTAGGAGCACGG + Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1050088678 9:1993411-1993433 CGGGATAAAGGGAAGGAGGAAGG - Intergenic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050515893 9:6444321-6444343 GATGGTAATCAAAAGGAGGAAGG + Intronic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1054362764 9:64193156-64193178 CAGGATAAACACTAGAAGGAAGG + Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1060035275 9:120250205-120250227 GAGGGTACGTAGAAGGAGGATGG - Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG + Intergenic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1191115291 X:56846236-56846258 CAGGGTATCCACAAGGAGGCTGG - Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191263421 X:58355068-58355090 CAGGATAAAAAGTAGGTGGAAGG + Intergenic
1191268452 X:58429515-58429537 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1191269150 X:58440185-58440207 CAGGGTAAAAACTAGAAGGAAGG - Intergenic
1191731212 X:64337624-64337646 CAGGGCAAAAAGAAAGATGAGGG + Intronic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1192698327 X:73442523-73442545 TAGGGTAAAAAGAATGAGAAAGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1195322020 X:103728153-103728175 CAGGGTCCAGAGAAGAAGGAAGG + Exonic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic