ID: 1116923956

View in Genome Browser
Species Human (GRCh38)
Location 14:50613878-50613900
Sequence ATGTATTTACATAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116923956 Original CRISPR ATGTATTTACATAAAGTGGG AGG Intronic
902193693 1:14782180-14782202 ATATATTTGCCTAAAGAGGGTGG - Intronic
902418266 1:16255860-16255882 CTATTTTTACATAAAGTGTGTGG - Intronic
903246449 1:22019376-22019398 ATGTAATTTCATAATGTGGCTGG + Intergenic
904250313 1:29218777-29218799 ATGTATTTACACATAGCTGGAGG + Intronic
906362069 1:45170288-45170310 ATGTTTTTGAGTAAAGTGGGAGG - Intronic
908481529 1:64544923-64544945 TTGTATATACTTAAAGTGTGAGG + Intronic
910021881 1:82601385-82601407 ATATAATAACATAAAGTAGGAGG - Intergenic
911356914 1:96834004-96834026 ATGTATTTACAAAAAAAGGAAGG - Intergenic
911528983 1:99021086-99021108 AAGTATTTACATAAAGATGAGGG + Intergenic
911937551 1:103998085-103998107 ATATATTTACAGAAATTTGGAGG + Intergenic
914574877 1:148955985-148956007 ATGTTTGTAAATAAAATGGGCGG + Intronic
915062329 1:153196591-153196613 ATATTTTTTAATAAAGTGGGAGG - Intergenic
915679477 1:157566736-157566758 AAGTATTTACATAAGCTGAGGGG - Intergenic
916243270 1:162660826-162660848 ATGTATTTACATATTGTCTGTGG + Intronic
916728559 1:167545629-167545651 TTGTATTTTCATAAAGAGGGTGG - Intronic
916737766 1:167623200-167623222 ATGTATTTTCGTAATTTGGGGGG - Intergenic
918039125 1:180901513-180901535 AGGTATATACAGAATGTGGGAGG + Intergenic
918742806 1:188157046-188157068 ATTTACTTACTTAAAATGGGGGG + Intergenic
919959680 1:202453818-202453840 ATTTCTTTACATAAAATGGAAGG + Intronic
921356080 1:214285542-214285564 ATGTATTTTTATAAAATAGGTGG + Intronic
924218753 1:241851960-241851982 ATTTTTTAACATAAAATGGGGGG + Intronic
1063396295 10:5691257-5691279 TTGTTTTTACATAATGTAGGAGG + Intronic
1066493760 10:35920341-35920363 TTCTGTTTATATAAAGTGGGAGG + Intergenic
1066593972 10:37028222-37028244 ATTTATTTACTTAATGTTGGAGG + Intergenic
1067241477 10:44498437-44498459 ATTGATTTCCATAATGTGGGTGG - Intergenic
1067485010 10:46640272-46640294 ATGTATTTTCATATTGTTGGAGG + Intergenic
1068163221 10:53294878-53294900 ATATATGTACATAAAGTGTTTGG - Intergenic
1069098586 10:64290129-64290151 ATATATTTACATACAGAAGGAGG - Intergenic
1071585683 10:86818796-86818818 ATGGAGTCAAATAAAGTGGGTGG - Intronic
1071625340 10:87162995-87163017 ATGTATTTTCATATTGTTGGAGG - Intronic
1071798796 10:89034847-89034869 ATATATTTATATAATATGGGAGG + Intergenic
1071998142 10:91166837-91166859 ATGTATATATATAATGTGTGTGG + Intronic
1072655136 10:97324602-97324624 CAGGATTTACATAAAGTGTGGGG + Intergenic
1074066904 10:110023935-110023957 ATGTTCTCACTTAAAGTGGGAGG + Intronic
1079507217 11:21166821-21166843 ATGTTTTTACATTTAGTGAGTGG - Intronic
1080111285 11:28570778-28570800 AGGTTTTTAGATAAAGTGTGTGG - Intergenic
1081549562 11:44098745-44098767 ATGTGTTTGCATATGGTGGGTGG + Intronic
1084503539 11:69551263-69551285 AGACATTTAAATAAAGTGGGTGG + Intergenic
1085894344 11:80620095-80620117 ATTTATTTACTTAATGTTGGAGG - Intergenic
1087715813 11:101607591-101607613 ATGAATTTCCATACAGTGGTGGG + Intronic
1088165261 11:106927435-106927457 ATTTATTTCTATAAACTGGGGGG + Intronic
1090681497 11:129063642-129063664 ATGTATTTGCATGGAGTGAGGGG + Intronic
1090885300 11:130870808-130870830 AGGTATATACATATAGTTGGGGG + Intergenic
1093591045 12:20903246-20903268 AGGTATTTACATAAATTAGTTGG + Intronic
1094181972 12:27601422-27601444 ATGCACTTAATTAAAGTGGGGGG + Intronic
1095375185 12:41518939-41518961 ATTTATTTATATAGAGTTGGGGG - Intronic
1096849565 12:54426977-54426999 ATTTATTTCCCTGAAGTGGGTGG + Intergenic
1098465069 12:70777515-70777537 ATATAATTACAAAAACTGGGAGG - Intronic
1099379117 12:81934480-81934502 ATGTATTTAACAAAAGTAGGAGG + Intergenic
1099384002 12:81992000-81992022 GTGTATTCACAGAAAGTGGATGG + Intergenic
1100457204 12:94763995-94764017 ATGTATTTGTACAAGGTGGGTGG + Intergenic
1100903973 12:99276478-99276500 ATGTGTTTACACAGAGTGGAGGG + Intronic
1101223923 12:102668564-102668586 ATGGATTTATATAAGGTGGGGGG - Intergenic
1103456200 12:121067918-121067940 ATGAATTTGGATAAAGTGGTTGG - Intergenic
1104771188 12:131365899-131365921 AGGCATTTCCATGAAGTGGGAGG - Intergenic
1106659607 13:31784814-31784836 ATGTATTAAGAGAAAGTTGGAGG - Intronic
1107282520 13:38753251-38753273 ATGTGTATACATAATTTGGGAGG - Intronic
1107457417 13:40567671-40567693 ATAAATTTACACAATGTGGGCGG + Intronic
1109360180 13:61285083-61285105 ATGGATTTAGATACAGTGGAAGG + Intergenic
1109417167 13:62055902-62055924 AAGTATTTACATAATTTGAGGGG - Intergenic
1111371553 13:87325660-87325682 ATGTTTTTACATAAGGAGAGAGG + Intergenic
1111408208 13:87838071-87838093 ATTTTTTTACATAAATAGGGTGG - Intergenic
1111825165 13:93258521-93258543 ATTTATTTACAGAAACTTGGGGG - Intronic
1112240481 13:97676707-97676729 AGGTAATTACATCATGTGGGTGG - Intergenic
1113204768 13:107903866-107903888 ATGTATTAACACAAACTGAGTGG - Intergenic
1114588860 14:23840762-23840784 ATGTGTTTACATTAAGAAGGGGG + Intergenic
1115167505 14:30465337-30465359 CTGTATTTCCATATAGTGGGTGG + Intergenic
1115887658 14:37991780-37991802 CTGTATGTACATCATGTGGGAGG + Intronic
1116596334 14:46851718-46851740 ATGTATTTACTTCAAGTGGACGG - Intronic
1116923956 14:50613878-50613900 ATGTATTTACATAAAGTGGGAGG + Intronic
1118043545 14:61942141-61942163 ATGTTTTTACATCAAGTTGTTGG + Intergenic
1122163361 14:99802540-99802562 CTGTATTTACATTAAGAGTGGGG + Intronic
1122698710 14:103572255-103572277 ATATATGTACATACAGTGCGGGG - Intronic
1122718836 14:103711000-103711022 TTCTATTTACATAAAGGGTGTGG - Intronic
1126380502 15:48041946-48041968 ATGTAATCACAGAAAGTGAGTGG + Intergenic
1126506445 15:49409289-49409311 GTTTATTTTCATAAAGGGGGTGG - Intronic
1126641711 15:50833700-50833722 ATATATATATATGAAGTGGGGGG - Intergenic
1127399092 15:58567784-58567806 ATGCATTTACATATATTGAGTGG - Intronic
1127700981 15:61500842-61500864 ATGTTATTCCATAAAGTGGAAGG - Intergenic
1128427871 15:67560905-67560927 ATTTATTTAAAAAAAGGGGGGGG - Intronic
1129130049 15:73485589-73485611 ATCTGGTTACATAAAGTGTGTGG + Intronic
1131031890 15:89193410-89193432 ATGTCTTTCCCTAAAGAGGGTGG - Intronic
1131533028 15:93210788-93210810 ATATATATACATAAACTGAGAGG + Intergenic
1131685552 15:94763841-94763863 ATTTGTTGACATAAAATGGGGGG - Intergenic
1132371225 15:101300797-101300819 ATGTACTCACATCCAGTGGGTGG - Intronic
1134805779 16:17123465-17123487 ATGTATTTGCATGAATTTGGGGG + Intronic
1135998982 16:27275769-27275791 ATGTATTGGCATAAAGTTTGTGG - Intronic
1136686829 16:32000080-32000102 ATGCATTTACAATAAGTGGAAGG - Intergenic
1136787442 16:32943622-32943644 ATGCATTTACAATAAGTGGAAGG - Intergenic
1136882338 16:33910162-33910184 ATGCATTTACAATAAGTGGAAGG + Intergenic
1139299761 16:65934976-65934998 ATGTATTTTCATATATTTGGGGG + Intergenic
1140672861 16:77296158-77296180 ATATATTTATATAAAATGGATGG - Intronic
1140889289 16:79271346-79271368 GGGTATTTACATACATTGGGAGG - Intergenic
1141080012 16:81042276-81042298 ATGCATTTTCATAAAGTGCTAGG - Exonic
1141744419 16:85915927-85915949 ATGGATTTACATAGAGGTGGGGG - Intronic
1203089671 16_KI270728v1_random:1205294-1205316 ATGCATTTACAATAAGTGGAAGG - Intergenic
1143276606 17:5715953-5715975 ATGTACTGACACAAGGTGGGGGG + Intergenic
1143431771 17:6893442-6893464 ATGTATTCACCAAAATTGGGTGG + Intronic
1144405041 17:14944088-14944110 ATGTATTAACATACAGTGGGTGG + Intergenic
1147147793 17:38495751-38495773 ATGCATTTACAATAAGTGGAAGG - Intronic
1152542484 17:80983234-80983256 ATGTAATTAGTTAATGTGGGTGG + Intergenic
1154042057 18:10865684-10865706 ACCTATTTACATTAAGTGGGTGG + Intronic
1155503280 18:26507793-26507815 TTGTATTTACATGAAGTGACAGG + Intronic
1156234609 18:35190057-35190079 CCGTATTTACATAAAATGGATGG + Intergenic
1157653980 18:49367000-49367022 ATGTTTCTACACAAAGTTGGGGG + Intronic
1157993436 18:52525491-52525513 ATTCATTTACACAAAGTGGATGG + Intronic
1159332962 18:67025116-67025138 CTGTATTTAAATAAAGGGGAAGG + Intergenic
1159790083 18:72767407-72767429 ATTTTTTTAAATAAAGTGTGTGG - Intronic
926898669 2:17724513-17724535 ATGGAATTACATAAAGTTGGTGG + Intronic
929914099 2:46119397-46119419 ATCTTTATAAATAAAGTGGGTGG + Intronic
930792109 2:55344209-55344231 TTATATTTATATAAAGTTGGAGG + Intronic
931578778 2:63750604-63750626 ATGTATGTTCATTAAGTGTGAGG + Intronic
931990991 2:67790237-67790259 AACTATTTACAAAAAGTTGGAGG - Intergenic
932962050 2:76424216-76424238 ATGAATTTAGATAAAGTTAGAGG + Intergenic
934939632 2:98491133-98491155 TTGTATTTCCAAAAAGGGGGCGG + Intronic
939771392 2:146324104-146324126 ATTTATTTACATCATGTGTGAGG + Intergenic
940144848 2:150534887-150534909 TTCTATTTACAAAAAATGGGTGG + Intronic
940623650 2:156145913-156145935 ATGTATTCACATTTACTGGGTGG - Intergenic
940717365 2:157242258-157242280 ATGCATTTACAATATGTGGGAGG - Intergenic
941270519 2:163421550-163421572 AGCTATTTTGATAAAGTGGGGGG + Intergenic
941571042 2:167171194-167171216 ATCTATTAAAATAAAGAGGGCGG - Intronic
943196182 2:184753240-184753262 ATGTATTTACAAAATGAGGCTGG + Intronic
944199720 2:197093073-197093095 ATGTATTTAAAGAATGAGGGAGG - Intronic
946114226 2:217447432-217447454 CTGGATTTACATCAAGTGTGAGG + Intronic
946283550 2:218684591-218684613 TTGTATTTTCATAGAGAGGGGGG + Intronic
948057675 2:235020961-235020983 ATGTATTTATAAAAAATAGGAGG - Intronic
1170312583 20:15008712-15008734 ATGCATGTACTTAAAGTGGATGG + Intronic
1174847986 20:53962589-53962611 GTGTATTTTTATAAAGTGAGTGG - Intronic
1175068507 20:56311615-56311637 ATGTTATTAAATAAAGTGTGTGG + Intergenic
1175090321 20:56497711-56497733 GTGTATTTCAATAAAGTTGGGGG - Intronic
1175928764 20:62483736-62483758 ATGTATGTGCATTAAGTGTGGGG - Intergenic
1177061047 21:16374510-16374532 ATTTATTTACATAGTGTGGGTGG - Intergenic
1177213530 21:18099790-18099812 ATGCGCTTAAATAAAGTGGGTGG + Intronic
1177903385 21:26945465-26945487 ATGTATTTATATAGATTTGGAGG - Intronic
1178175529 21:30093695-30093717 ATGTTCTCACTTAAAGTGGGAGG + Intergenic
1179374699 21:40839968-40839990 ATGTATTTACATAATCCAGGGGG + Intronic
1180884804 22:19234279-19234301 ACGTATGCACACAAAGTGGGAGG + Intronic
1182919504 22:34066410-34066432 ATGTATTTACATATTGTCTGTGG - Intergenic
949502530 3:4694966-4694988 CTGCATTTACAAAAAGGGGGTGG - Intronic
950624699 3:14236456-14236478 ATGTCTTTACACAACGTGGATGG - Intergenic
950652036 3:14413241-14413263 ATGTATTTAAATAATGGGGGAGG - Intronic
952222540 3:31339602-31339624 AAGTTTTTTCAGAAAGTGGGAGG - Intergenic
952799773 3:37279042-37279064 ATGTATATACACAAAGACGGGGG + Intronic
953016633 3:39083112-39083134 ATGGATTTAAATAAAGAGGGTGG + Intronic
953656276 3:44857266-44857288 AAGTATATGCATCAAGTGGGAGG + Intronic
954149503 3:48650390-48650412 ATGTCTTTTCCTAAATTGGGTGG - Intronic
956459363 3:69455282-69455304 GTCTGTTTACATAATGTGGGAGG + Intronic
958519781 3:95169665-95169687 ATATATATATATGAAGTGGGTGG + Intergenic
960302215 3:116016985-116017007 CTGTATTTACATAAACTCAGAGG - Intronic
962477473 3:135768529-135768551 ATGTTTATATTTAAAGTGGGGGG - Intergenic
962634901 3:137320572-137320594 ATGTGTTTTCATAAGGTGAGTGG + Intergenic
962975600 3:140443124-140443146 CTGGATTTACACAAAGTGAGTGG - Intronic
964128391 3:153260782-153260804 ATGTATTTAAATTATGTGGCAGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964941869 3:162167892-162167914 ATGTCTTCACCTAAAGTTGGGGG - Intergenic
965319805 3:167239241-167239263 ATTAGTTTACATAACGTGGGTGG - Intergenic
967125111 3:186416230-186416252 CTTTATTTACAAAAAGTGGTGGG - Intergenic
967784025 3:193470476-193470498 ATGTTTTTAAATAAACTTGGAGG - Intronic
970034438 4:11716481-11716503 ATGCATTTACATATTGTTGGTGG - Intergenic
971074031 4:23127427-23127449 ATGTATCTACATAAAGTATGTGG + Intergenic
973684146 4:53352787-53352809 ATGTAAATTCATAAAATGGGAGG + Intronic
974137759 4:57840134-57840156 CTTTATTTAAATAAAATGGGAGG + Intergenic
974250873 4:59381284-59381306 TTGGATCTACTTAAAGTGGGAGG + Intergenic
975480270 4:74871068-74871090 ATTTATTTACATAAACTATGAGG + Intergenic
976651651 4:87441094-87441116 ATTTACTTTCATATAGTGGGAGG + Intronic
976916384 4:90380300-90380322 ATGTATTTTTATAAAGAGAGAGG - Intronic
977465159 4:97374647-97374669 ATGTATTCACATTAACTGTGAGG - Intronic
977679349 4:99781851-99781873 ATGTATTTATAGAAAATGGCTGG - Intergenic
979271735 4:118770159-118770181 ATGTATTTAAATAAAGTTCCTGG - Intronic
979554889 4:122034288-122034310 ATATTTTTACATAAGGTAGGTGG + Intergenic
980295107 4:130903513-130903535 AAGTATTTTCATTCAGTGGGTGG + Intergenic
980312947 4:131158200-131158222 ATGTATCTACAGAAATTAGGTGG + Intergenic
980761177 4:137236333-137236355 ATGTATTTGCATAATTTAGGGGG + Intergenic
980977383 4:139624181-139624203 ATGTTTTTACATAACCTGGAGGG - Intergenic
981495067 4:145381728-145381750 ATGTAGTTGAATAAAGTAGGAGG - Intergenic
983261822 4:165465343-165465365 ATTTATTTACAGAAATTGGCTGG - Intronic
983868170 4:172792849-172792871 ATTTATATAGATAAAGAGGGAGG - Intronic
987827771 5:23055639-23055661 ATCTAAGTACATAGAGTGGGCGG - Intergenic
987888287 5:23840515-23840537 TTGTATATACATAAAGTGTCAGG + Intergenic
988049030 5:25999513-25999535 ATATATATATATAAAGTGTGTGG + Intergenic
988398996 5:30736712-30736734 ATGTATATGCTTAAACTGGGAGG - Intergenic
989280947 5:39642837-39642859 ATGTAGTTCCATAAATTGAGGGG - Intergenic
989800790 5:45536090-45536112 ATGAAATTACATAGAGTGAGAGG - Intronic
990753369 5:59041060-59041082 ATATATTTACATAGACTGCGGGG - Intronic
991504222 5:67307357-67307379 ATGTATATGGAAAAAGTGGGCGG + Intergenic
992481601 5:77157202-77157224 CTCTATTTAAATATAGTGGGTGG + Intergenic
992975028 5:82107201-82107223 CTGTTTATACATAAAGTCGGTGG + Intronic
993461874 5:88192036-88192058 ATGAATTTACATTAAATGTGTGG - Intronic
993959850 5:94284290-94284312 ATGAATGTATATGAAGTGGGTGG + Intronic
994363307 5:98881031-98881053 TTGTAATTACATAAATTGAGAGG - Intronic
995026020 5:107423658-107423680 AAGTAATTACAGAAAGTTGGCGG - Intronic
995651392 5:114372714-114372736 ATGTATTTATATAAAGTATATGG + Intronic
995877421 5:116805001-116805023 ATGTATTTATATAAAATTGAAGG + Intergenic
997862954 5:137435618-137435640 ATTTCTTTAAGTAAAGTGGGAGG + Intronic
1001355169 5:171014210-171014232 ATGTCTTTATATAAATAGGGTGG + Intronic
1001490980 5:172155090-172155112 ATGAATGGACAGAAAGTGGGTGG + Intronic
1001685157 5:173588990-173589012 GGGTATTTACATAAGGTGTGAGG - Intergenic
1004209199 6:13620657-13620679 ATGTAATTACTAAAACTGGGTGG - Intronic
1005209065 6:23440073-23440095 ATGTATTTACAAAAAGAAGCAGG - Intergenic
1005458810 6:26047884-26047906 ATGTATTTGAATAGAGTGGTAGG - Intergenic
1008887210 6:56444379-56444401 CTGTATTTCCATATAGAGGGAGG - Intergenic
1008935087 6:56982755-56982777 ATGTAATTACTTATATTGGGGGG - Intronic
1009771504 6:68148548-68148570 ATGTATTTAAATAAGGAGGCAGG - Intergenic
1010321817 6:74519526-74519548 ATTTATTTACATAAATTGTTGGG - Intergenic
1010882380 6:81194037-81194059 ATTTACTTACATAATGTGGAAGG - Intergenic
1011311221 6:85981643-85981665 ATCTATTTCCATAAACTGTGGGG + Intergenic
1012007443 6:93731442-93731464 ATGTACTTACACAAAGTAGATGG + Intergenic
1012503648 6:99919484-99919506 ATGTATTTAGATGAAGAAGGTGG + Intergenic
1012589831 6:100967598-100967620 TTTAATTTTCATAAAGTGGGAGG + Intergenic
1015141455 6:129938466-129938488 ATGTAAATACATACAGAGGGAGG - Intergenic
1016516358 6:144896832-144896854 ATGTATTTGCAAGAAATGGGAGG - Intergenic
1016578232 6:145596667-145596689 ATGTTTTTACAAAATGTGGGAGG - Intronic
1016832011 6:148443508-148443530 ATGTATATACATATATTGTGAGG + Intronic
1017034481 6:150254864-150254886 ATGTATCTACATAATATGAGTGG + Intergenic
1019819124 7:3227677-3227699 ATGTATATATATAAAGTGCTGGG + Intergenic
1020344786 7:7151394-7151416 ATGTATATACATACAGTGGCTGG + Intergenic
1021104431 7:16620565-16620587 ATGTATTTCCCTAAAGTGATTGG - Intronic
1022086311 7:27071160-27071182 ATATATTTACATATATTGGCTGG + Intergenic
1022227346 7:28376852-28376874 ATGTATTTACATAACTAGGTTGG + Intronic
1023672806 7:42597140-42597162 ATGAATTTGCATAAACTGTGGGG - Intergenic
1024224451 7:47315020-47315042 ATGTGTTTCCACAACGTGGGAGG + Intronic
1025611897 7:63081863-63081885 ATGTTTTTACACAAAAAGGGGGG + Intergenic
1027525206 7:79260347-79260369 ATGTATTTACTTAGAGATGGGGG - Intronic
1027764156 7:82318516-82318538 AAGTATTTACATAAAATGTGTGG - Intronic
1028110624 7:86936211-86936233 ATGTATTTATATAAAGAGACAGG + Intronic
1028362755 7:89988649-89988671 ATCTATTTCATTAAAGTGGGTGG - Intergenic
1028797848 7:94925271-94925293 ATTTCTTTCCATAATGTGGGTGG - Intronic
1029151827 7:98485716-98485738 ATGTAGCTACATGGAGTGGGTGG + Intergenic
1030353818 7:108521580-108521602 ATGAATTAAAATAAAGCGGGAGG + Intronic
1030541514 7:110836281-110836303 AAGTATTGTCATAAATTGGGGGG + Intronic
1031648540 7:124257052-124257074 ATGTTTTTGGCTAAAGTGGGAGG + Intergenic
1034143096 7:148841516-148841538 ATGTCTTTAAATTAAGTGGATGG - Intronic
1038360822 8:26874218-26874240 ATGAATTTATATAAAGAGAGAGG + Intergenic
1041138084 8:54782374-54782396 ATGTATATACAGACAGTGGTGGG + Intergenic
1043292031 8:78613894-78613916 ATTTATTTACATAAAGTGCCAGG - Intergenic
1044652203 8:94507862-94507884 ATGTATATATATAAAGTAGAGGG - Intronic
1044720839 8:95144568-95144590 ATGCATTTAAAAAAAATGGGTGG + Intronic
1045958497 8:107938470-107938492 ATTTATTTTCACTAAGTGGGTGG - Intronic
1046886074 8:119368546-119368568 ATTTATTAACATGTAGTGGGTGG - Intergenic
1047465818 8:125113041-125113063 ATATATTAACAGAAAATGGGGGG + Intronic
1047539283 8:125748624-125748646 AGATATTTACATGAGGTGGGTGG + Intergenic
1047672578 8:127164383-127164405 ATGTATTCACAGAAAGTAGGTGG + Intergenic
1048687154 8:136917387-136917409 ATCTATTTGCATAAAGTAAGAGG - Intergenic
1048951843 8:139502807-139502829 ATGTACTTTCATAAAGCTGGGGG + Intergenic
1051279772 9:15430600-15430622 ATGTATTTTCATATTGTTGGAGG - Intronic
1051858819 9:21600917-21600939 ATGGGCTTATATAAAGTGGGTGG + Intergenic
1052349718 9:27446213-27446235 ATGTATTCCCAAAAATTGGGAGG - Intronic
1053145476 9:35709060-35709082 ATGCATTTTCAGAAGGTGGGGGG + Intronic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1056898286 9:90572255-90572277 ATGTACATACATAAAGAGGAAGG + Intergenic
1058107654 9:100990995-100991017 ATGTATTTACATATTGTCTGTGG + Intergenic
1061093086 9:128437746-128437768 ATGTATATATATAAAGTGGCAGG - Intergenic
1061878958 9:133559040-133559062 ATGTAATTAGATAAAGATGGCGG + Intronic
1186405326 X:9296754-9296776 ATTTATTTAAATAAAGGGAGGGG + Intergenic
1186505780 X:10091042-10091064 ACGTACTTAAATACAGTGGGGGG - Intronic
1186791054 X:12999152-12999174 AGGTATTTACATGGAGAGGGTGG + Intergenic
1186932007 X:14404187-14404209 GTCTAATTACATAAAGTTGGTGG - Intergenic
1188294139 X:28425632-28425654 ATTTATTTAAATAAAATGGAAGG - Intergenic
1188742247 X:33800209-33800231 ATTTAGTTACAAAAAGTGGCCGG - Intergenic
1188958398 X:36461830-36461852 ATATATTGACATTAAGTGAGGGG - Intergenic
1189902031 X:45716411-45716433 ATGTACTTACATATGGTGGGTGG - Intergenic
1189999504 X:46671946-46671968 ATGTATCTACATAAAGTATTTGG + Intronic
1194018001 X:88650195-88650217 ATGTGTATAGATAAAGTGTGTGG - Intergenic
1195207324 X:102615402-102615424 ATGTTTTCAGATAAAGTGGGTGG + Intergenic
1195403337 X:104485608-104485630 ATGTATTCACTTAAAGTTGATGG - Intergenic
1195891784 X:109703082-109703104 ATGTATTAATAAAAAGTGTGTGG + Intronic
1196200423 X:112880409-112880431 TTGTATTCACATAAAAAGGGAGG + Intergenic
1196427089 X:115581494-115581516 AGGTATTTAAAAAAAGAGGGAGG + Intronic