ID: 1116925825

View in Genome Browser
Species Human (GRCh38)
Location 14:50635868-50635890
Sequence CTAAAAATACAGAAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47258
Summary {0: 3, 1: 211, 2: 8927, 3: 22915, 4: 15202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116925825_1116925828 7 Left 1116925825 14:50635868-50635890 CCCAGCTACTTCTGTATTTTTAG 0: 3
1: 211
2: 8927
3: 22915
4: 15202
Right 1116925828 14:50635898-50635920 AGAGTTTCACCATGTTGGCCAGG 0: 2254
1: 39161
2: 131464
3: 186810
4: 200210
1116925825_1116925827 2 Left 1116925825 14:50635868-50635890 CCCAGCTACTTCTGTATTTTTAG 0: 3
1: 211
2: 8927
3: 22915
4: 15202
Right 1116925827 14:50635893-50635915 GAGACAGAGTTTCACCATGTTGG 0: 2300
1: 38457
2: 91951
3: 133968
4: 111703
1116925825_1116925829 10 Left 1116925825 14:50635868-50635890 CCCAGCTACTTCTGTATTTTTAG 0: 3
1: 211
2: 8927
3: 22915
4: 15202
Right 1116925829 14:50635901-50635923 GTTTCACCATGTTGGCCAGGAGG 0: 593
1: 1340
2: 1687
3: 1846
4: 2182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116925825 Original CRISPR CTAAAAATACAGAAGTAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr