ID: 1116928651

View in Genome Browser
Species Human (GRCh38)
Location 14:50668202-50668224
Sequence CCCGAGCAGCGTCGCAGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 2, 1: 0, 2: 1, 3: 5, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116928651_1116928658 8 Left 1116928651 14:50668202-50668224 CCCGCTCTGCGACGCTGCTCGGG 0: 2
1: 0
2: 1
3: 5
4: 82
Right 1116928658 14:50668233-50668255 GAGGAAAGCCCAGCGACGCCGGG 0: 2
1: 0
2: 0
3: 12
4: 123
1116928651_1116928660 14 Left 1116928651 14:50668202-50668224 CCCGCTCTGCGACGCTGCTCGGG 0: 2
1: 0
2: 1
3: 5
4: 82
Right 1116928660 14:50668239-50668261 AGCCCAGCGACGCCGGGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 125
1116928651_1116928657 7 Left 1116928651 14:50668202-50668224 CCCGCTCTGCGACGCTGCTCGGG 0: 2
1: 0
2: 1
3: 5
4: 82
Right 1116928657 14:50668232-50668254 TGAGGAAAGCCCAGCGACGCCGG 0: 2
1: 0
2: 1
3: 16
4: 114
1116928651_1116928666 26 Left 1116928651 14:50668202-50668224 CCCGCTCTGCGACGCTGCTCGGG 0: 2
1: 0
2: 1
3: 5
4: 82
Right 1116928666 14:50668251-50668273 CCGGGCCAGGGCCAGGGCCATGG 0: 2
1: 89
2: 197
3: 471
4: 2227
1116928651_1116928659 13 Left 1116928651 14:50668202-50668224 CCCGCTCTGCGACGCTGCTCGGG 0: 2
1: 0
2: 1
3: 5
4: 82
Right 1116928659 14:50668238-50668260 AAGCCCAGCGACGCCGGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 145
1116928651_1116928664 20 Left 1116928651 14:50668202-50668224 CCCGCTCTGCGACGCTGCTCGGG 0: 2
1: 0
2: 1
3: 5
4: 82
Right 1116928664 14:50668245-50668267 GCGACGCCGGGCCAGGGCCAGGG 0: 1
1: 0
2: 3
3: 24
4: 274
1116928651_1116928663 19 Left 1116928651 14:50668202-50668224 CCCGCTCTGCGACGCTGCTCGGG 0: 2
1: 0
2: 1
3: 5
4: 82
Right 1116928663 14:50668244-50668266 AGCGACGCCGGGCCAGGGCCAGG 0: 1
1: 0
2: 1
3: 34
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116928651 Original CRISPR CCCGAGCAGCGTCGCAGAGC GGG (reversed) Exonic
906074092 1:43039260-43039282 CCCGAGCTGAGCCCCAGAGCAGG - Intergenic
906940586 1:50251954-50251976 GCCGAGCAGCGCGGCAGAGGTGG - Intergenic
907136257 1:52142166-52142188 CCGGAGGAGCGCCGCCGAGCCGG - Exonic
907731135 1:57067104-57067126 CCCCAGCAGACTGGCAGAGCAGG + Intronic
912823034 1:112882644-112882666 CCTGAACAGTGTCCCAGAGCAGG + Intergenic
913513190 1:119581062-119581084 CCCGAGCAGTGGTGCAGAGGAGG + Intergenic
916026441 1:160837576-160837598 CCTGTGCAGCCTCGCAGAGCAGG - Intronic
923368817 1:233289859-233289881 CCTGCGCAGCCTCGCATAGCAGG - Intronic
1065470893 10:26080852-26080874 CCCCAGCAGCAGCCCAGAGCTGG - Intronic
1067249608 10:44575648-44575670 CCCAAGCAGGGTGGCTGAGCAGG + Intergenic
1070329613 10:75408128-75408150 CCCGCGCAGCCTCTCAGGGCCGG - Intergenic
1077301841 11:1850980-1851002 CCCGAGCGGCTTCGTAGACCTGG + Intergenic
1081700166 11:45147459-45147481 CCCGCGAAGCGTGGCCGAGCCGG + Exonic
1083273039 11:61581417-61581439 ACCGGGCAGGGCCGCAGAGCCGG + Intergenic
1089341997 11:117764220-117764242 CCCCAGCAGTGCCCCAGAGCAGG - Intronic
1091133549 11:133167151-133167173 CCCGAGCAGCCTTCCAGCGCCGG - Intronic
1091663187 12:2399612-2399634 GCAGAGCAGCGTGGCAGAGAAGG - Intronic
1092885236 12:12918964-12918986 CCCGTGCAGCTTCTGAGAGCAGG + Intergenic
1096675081 12:53221807-53221829 CACGGGCAGCGCCGCGGAGCGGG + Intronic
1101815219 12:108140856-108140878 CCTGGGCATCGTGGCAGAGCTGG + Intronic
1103447226 12:121002120-121002142 CCCGAGCAGCTGAGCAGGGCCGG + Exonic
1104602502 12:130162842-130162864 CCCGAGCAGGGGTGGAGAGCCGG + Exonic
1104736284 12:131137663-131137685 GCAGAGCAGAGTCGCTGAGCAGG + Intronic
1107470851 13:40689795-40689817 CCAGGGCAGCTTCCCAGAGCAGG - Intergenic
1113506220 13:110818290-110818312 CACGGGCAGTGCCGCAGAGCAGG - Intergenic
1113668246 13:112155747-112155769 TCCGAGCAGCTTCTCAGAGCTGG - Intergenic
1116928651 14:50668202-50668224 CCCGAGCAGCGTCGCAGAGCGGG - Exonic
1117253664 14:53957051-53957073 CCCCAGCCGCTTCCCAGAGCTGG - Intronic
1122144132 14:99679121-99679143 CCACAGCAGGGTCCCAGAGCTGG - Exonic
1122781588 14:104146080-104146102 CACCACCAGGGTCGCAGAGCTGG - Intronic
1127606165 15:60591233-60591255 CCCGAGCTGCTTCGCAGGCCCGG - Intronic
1131156871 15:90080981-90081003 CCCGAGCAGCCTGGCCGGGCAGG + Exonic
1141580219 16:84992668-84992690 CCCGGGCACCTTCTCAGAGCAGG + Intronic
1142742300 17:1938109-1938131 CCCCAGCAGTGTGACAGAGCTGG - Intronic
1148081657 17:44970340-44970362 CCCCAGCGGCGTAGCAGAGGAGG - Intergenic
1148207016 17:45785228-45785250 CCCGATCCGCGTCGCAGGGTCGG - Intronic
1150221528 17:63498082-63498104 CCCGAGCAGAGTCATGGAGCTGG - Intronic
1150311056 17:64129899-64129921 CCGGGGCAGCGTCGCGGCGCCGG - Intronic
1151472837 17:74328442-74328464 GCCCATCAGCGTGGCAGAGCTGG + Exonic
1152253993 17:79226900-79226922 CCCGAGCAACTTGTCAGAGCTGG - Intronic
1152809381 17:82374345-82374367 CCCGAGCAGCTTCCCTGGGCTGG + Exonic
1161210290 19:3062232-3062254 CCCGAGCCGGGGCGCACAGCCGG - Intronic
1165112189 19:33508941-33508963 CCAGAGCAGCATCACAGAGAAGG + Intronic
1168224143 19:54982460-54982482 CCCGTGCAGTTTTGCAGAGCTGG + Exonic
929460889 2:42101478-42101500 CCCGAGCAGCACGGCGGAGCCGG - Intergenic
929871839 2:45765765-45765787 CCAGAGCAGCTTCCCAGAACTGG + Intronic
931426602 2:62177357-62177379 CCAGAGCAGCCTCCCAGGGCAGG + Intergenic
932476348 2:72008752-72008774 CCCGAGCAGTGAGGCTGAGCAGG - Intergenic
934912901 2:98275506-98275528 CCTGAGTAGCGTCACACAGCTGG + Intronic
935762397 2:106333549-106333571 CCTGAGCAGGGTGCCAGAGCTGG + Intergenic
936556873 2:113503788-113503810 CCCGCGCCGCCCCGCAGAGCCGG + Intergenic
948730077 2:239957228-239957250 CCCGGGCAGCATCTCAGCGCTGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172118375 20:32584342-32584364 CCCGGGCAGCGGCGCGGAGGGGG + Intronic
1172121221 20:32599931-32599953 CCCGAGCAAGGTCACACAGCTGG - Intronic
1175983625 20:62753574-62753596 CCCGGGCAGCTTGGCAGAGAGGG + Intronic
1177153949 21:17482662-17482684 CCCGAGGAGCTCTGCAGAGCTGG - Intergenic
1180157939 21:45987012-45987034 CCAGAGCCGCGACGCAGAGGAGG + Exonic
1182077489 22:27504849-27504871 CTCGTGCAGCGTTGGAGAGCAGG - Intergenic
1182771790 22:32801690-32801712 CCCAGGCAGCGGCGCAGAGCGGG + Exonic
1183287673 22:36977579-36977601 CCCCCGCAGCGGAGCAGAGCTGG + Intergenic
1185291920 22:50031538-50031560 ACCGAGCATGGTCACAGAGCAGG + Intronic
950168029 3:10816215-10816237 CCGGGGCGGCGGCGCAGAGCCGG + Exonic
950583569 3:13878508-13878530 CCCGACCAGCGGCGGAGAGGCGG - Intronic
952888985 3:38028902-38028924 CCCGAGGAGGGTCGCAGATGAGG + Intronic
952959203 3:38579286-38579308 CCCAAGCAGCGGCGCCCAGCTGG + Intronic
953906552 3:46871354-46871376 CCCAAGCAGAGTAGCTGAGCCGG + Intronic
968654240 4:1771773-1771795 CCCGAGCTGCGGTGCAGAACTGG - Intergenic
973110378 4:46390276-46390298 CACTAGCAGCGGCGCAGACCCGG + Intronic
977359540 4:95984763-95984785 GCAGAGCAGCGTGGCAGAGAAGG - Intergenic
981366707 4:143912300-143912322 CCCGAGCAGCGTCGCAGAGCGGG - Intergenic
988530448 5:32022885-32022907 CTCAAGCAGCGTGGCAGAGGAGG + Intronic
994105319 5:95941407-95941429 CCCAAGCAGCATTGCAAAGCAGG - Intronic
997613352 5:135230336-135230358 TCCGAGCAGACTGGCAGAGCAGG + Intronic
1004123771 6:12852235-12852257 GCCAAGCAACGTCCCAGAGCTGG + Intronic
1005928908 6:30466345-30466367 CCGGAGGAGCGCCGCGGAGCAGG - Intergenic
1018068089 6:160137643-160137665 GCTGAACAGCGTAGCAGAGCGGG - Intronic
1018330975 6:162727485-162727507 CCGGACCCGCGTCGCTGAGCTGG + Intronic
1019328331 7:450664-450686 GCAGAGCAGGGTCTCAGAGCAGG - Intergenic
1024561696 7:50650089-50650111 ACCAAGCAGCCTGGCAGAGCAGG + Intronic
1024707221 7:51973355-51973377 CCAGAGCAGCGTCCCTGACCAGG - Intergenic
1024996993 7:55279609-55279631 CCCAGGCTGCGTCTCAGAGCAGG + Intergenic
1029382866 7:100224880-100224902 CCCCAGCAGCTTAGCAGAGTAGG + Intronic
1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG + Exonic
1038012129 8:23483590-23483612 GCCCAGCAGCGTCGCAGAGCGGG - Intergenic
1052337909 9:27338395-27338417 TCCCAGCAGCGCCCCAGAGCTGG + Intronic
1056386351 9:86099813-86099835 CCTGAGCAGCGACGCGGAGCGGG + Intronic
1188099978 X:26071537-26071559 GCCAAGCAGCGTCGCTCAGCAGG - Intergenic
1191192271 X:57679481-57679503 CCCGTGCAGTTTTGCAGAGCTGG - Intergenic
1192818026 X:74614553-74614575 CCTGAGCAACGTCTCCGAGCAGG - Exonic