ID: 1116928848

View in Genome Browser
Species Human (GRCh38)
Location 14:50669760-50669782
Sequence GTTTATGTACTGGAAAAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116928841_1116928848 12 Left 1116928841 14:50669725-50669747 CCATGTTCCTGGCAGATTGGAGG No data
Right 1116928848 14:50669760-50669782 GTTTATGTACTGGAAAAGACGGG No data
1116928843_1116928848 5 Left 1116928843 14:50669732-50669754 CCTGGCAGATTGGAGGAACAGTA No data
Right 1116928848 14:50669760-50669782 GTTTATGTACTGGAAAAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116928848 Original CRISPR GTTTATGTACTGGAAAAGAC GGG Intergenic
No off target data available for this crispr