ID: 1116929969

View in Genome Browser
Species Human (GRCh38)
Location 14:50680852-50680874
Sequence CAACATACACAAATCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116929969_1116929971 -2 Left 1116929969 14:50680852-50680874 CCATGTTTGATTTGTGTATGTTG No data
Right 1116929971 14:50680873-50680895 TGAACCATACTTGCATTCCTGGG No data
1116929969_1116929970 -3 Left 1116929969 14:50680852-50680874 CCATGTTTGATTTGTGTATGTTG No data
Right 1116929970 14:50680872-50680894 TTGAACCATACTTGCATTCCTGG No data
1116929969_1116929974 19 Left 1116929969 14:50680852-50680874 CCATGTTTGATTTGTGTATGTTG No data
Right 1116929974 14:50680894-50680916 GGATAAATCCCACTTGATCATGG 0: 129
1: 508
2: 8016
3: 4997
4: 4957

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116929969 Original CRISPR CAACATACACAAATCAAACA TGG (reversed) Intergenic
No off target data available for this crispr