ID: 1116929969 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:50680852-50680874 |
| Sequence | CAACATACACAAATCAAACA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1116929969_1116929971 | -2 | Left | 1116929969 | 14:50680852-50680874 | CCATGTTTGATTTGTGTATGTTG | No data | ||
| Right | 1116929971 | 14:50680873-50680895 | TGAACCATACTTGCATTCCTGGG | No data | ||||
| 1116929969_1116929970 | -3 | Left | 1116929969 | 14:50680852-50680874 | CCATGTTTGATTTGTGTATGTTG | No data | ||
| Right | 1116929970 | 14:50680872-50680894 | TTGAACCATACTTGCATTCCTGG | No data | ||||
| 1116929969_1116929974 | 19 | Left | 1116929969 | 14:50680852-50680874 | CCATGTTTGATTTGTGTATGTTG | No data | ||
| Right | 1116929974 | 14:50680894-50680916 | GGATAAATCCCACTTGATCATGG | 0: 129 1: 508 2: 8016 3: 4997 4: 4957 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1116929969 | Original CRISPR | CAACATACACAAATCAAACA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||