ID: 1116940798

View in Genome Browser
Species Human (GRCh38)
Location 14:50789024-50789046
Sequence GACTTCTGGATCCCAGCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116940798_1116940802 12 Left 1116940798 14:50789024-50789046 CCCTAAGCTGGGATCCAGAAGTC 0: 1
1: 0
2: 1
3: 7
4: 135
Right 1116940802 14:50789059-50789081 CAATCAAAACAAAGAAGACCTGG 0: 1
1: 1
2: 3
3: 35
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116940798 Original CRISPR GACTTCTGGATCCCAGCTTA GGG (reversed) Intronic
902598533 1:17525370-17525392 GCCTCCTGGCTCCCAGCCTAGGG - Intergenic
905329621 1:37184386-37184408 GATTTCTGAATTCCAACTTAGGG - Intergenic
906345566 1:45012402-45012424 GGATTCAGGATCCCAGCTAACGG - Intronic
906392568 1:45431622-45431644 CACCTCTGGTTCCCAGCTTGTGG + Intronic
907396178 1:54191627-54191649 GACCCCTCAATCCCAGCTTAGGG + Intronic
908258585 1:62321714-62321736 GGCTTCTGAAGCCCAGGTTAGGG + Intergenic
908566603 1:65363323-65363345 GACTTCTGGGTCCCAGAGAAAGG - Intronic
909764545 1:79339094-79339116 GACTACTGGATTCCAGTCTATGG + Intergenic
914436468 1:147664607-147664629 GACTTCTGTTTCCCAGCAAAGGG + Intronic
920662885 1:207933074-207933096 GATTGCTGGATCCCAGCTCCAGG + Intergenic
920883424 1:209900914-209900936 GAATCCTGGAGCCCAGATTAAGG - Intergenic
921290519 1:213652623-213652645 GGCTTCTGGTTCCCTGCTTTCGG + Intergenic
922553983 1:226519190-226519212 TTCTTCTGGATCCCAGATTCTGG - Intergenic
1066301482 10:34101329-34101351 GACTTCTAGGTCCCATCTTTAGG + Intergenic
1066495683 10:35939522-35939544 GAGATCTGGATCTCAGCTTCAGG - Intergenic
1066646634 10:37617420-37617442 GAGATCTGGATCTCAGCTTCAGG + Intergenic
1069448688 10:68498273-68498295 GAATTCTGGATCAGAGCTCAAGG + Intronic
1069751049 10:70745200-70745222 GACTTCTGGATCCCTGTGTGTGG + Intronic
1083294143 11:61706254-61706276 GCCCTCTGGAGCCCAGCTCAAGG - Intronic
1085637806 11:78171922-78171944 GACTCCTGGGTCCCACCGTAGGG + Exonic
1087208496 11:95421346-95421368 TGCTCCAGGATCCCAGCTTAGGG - Intergenic
1087940888 11:104095423-104095445 TACTTATGGAACCCAGATTAGGG - Intronic
1089539300 11:119180391-119180413 GACTTCTTCATCCCACCTTCTGG - Intronic
1089608130 11:119653657-119653679 GAGTTCTGTTTCCCTGCTTAGGG + Intronic
1091797870 12:3307585-3307607 CACATCTGGATCCCAGCTGCTGG - Intergenic
1091991418 12:4959039-4959061 GCCTTGTGAATCCCAGCTTTTGG - Intergenic
1092167895 12:6354327-6354349 GACTTCTGGCTCCCACCTGCTGG - Intronic
1095922026 12:47541304-47541326 GAGCTCTGGATCTCAGCTTGTGG - Intergenic
1096002994 12:48144904-48144926 GACTTCTGGATTCCTGTTTTGGG + Intronic
1099541753 12:83918337-83918359 GCCCTTTGGATCCAAGCTTAAGG - Intergenic
1099607238 12:84819895-84819917 AATTTCTGGATCCCTGGTTAAGG - Intergenic
1099871295 12:88352361-88352383 GAGGTCTGAATCCTAGCTTAGGG + Intergenic
1100498444 12:95148312-95148334 GACATCTGGATCCAGGCCTAGGG + Intronic
1101973868 12:109337753-109337775 GACTTCTGGAACCCTGCTTTTGG + Intergenic
1102031316 12:109741631-109741653 GACTTCTGGACCCCAGTAAAAGG + Intronic
1103111904 12:118287536-118287558 GACTTCTGTTTTCCAGTTTAGGG - Intronic
1115287852 14:31736726-31736748 GACTGCTGGATTTTAGCTTAGGG + Intronic
1115459504 14:33644677-33644699 GGCTTCTCCATCCCAGCCTAGGG + Intronic
1116940798 14:50789024-50789046 GACTTCTGGATCCCAGCTTAGGG - Intronic
1117677720 14:58171354-58171376 TGCTTCTGGCTCCCAGCTGAGGG - Intronic
1121450162 14:94001876-94001898 GACTTCGGGATCCCAGAGGAAGG + Intergenic
1121615073 14:95308317-95308339 GAAAACTGGATCCCAGCTAAAGG - Intronic
1124795734 15:32776328-32776350 GACTGCTGGTTTCCAGCATAGGG + Intronic
1125420197 15:39497474-39497496 GAGGTCTGAATCCCAGCCTAGGG - Intergenic
1126458378 15:48889407-48889429 GTCTTCAGATTCCCAGCTTAGGG - Intronic
1143863656 17:9908799-9908821 GGCGTCTGGGTCCCAGCTAATGG - Intergenic
1144177528 17:12721459-12721481 TACTTTTGGGTCCCAGCATAAGG - Intronic
1145853046 17:28122055-28122077 GAAGTCTGGGTGCCAGCTTAGGG - Intronic
1146302374 17:31699508-31699530 GGCTTCCGGCTCCCAGCTCAGGG + Intergenic
1147434749 17:40403209-40403231 AACTTCTGGCTCCAAGTTTAGGG + Intronic
1148818571 17:50347195-50347217 GACCTCTGGGCCACAGCTTAGGG - Intronic
1149915705 17:60607049-60607071 GACTTCTTGAACCCAGGGTAAGG - Intronic
1150584848 17:66508158-66508180 GGGTGCTGGATCCCAGCTTCTGG - Intronic
1150939015 17:69669886-69669908 GGTTTCTGGATCCCAGCCTGAGG - Intergenic
1151590646 17:75041955-75041977 GCCCTCTGGCTCCCAGATTAAGG + Intronic
1152056030 17:78027616-78027638 AACCTCTGGATCCTATCTTAGGG - Intronic
1156239553 18:35240192-35240214 GACTCCTGGAGCCTATCTTAGGG - Intergenic
1156685205 18:39636919-39636941 GACTTCTGGAACCCAGATACAGG - Intergenic
1157633743 18:49128514-49128536 GACTCCTGGATCTCAGATTTGGG - Intronic
1159315029 18:66761826-66761848 GTCTTCTGGATACCTGCTGAAGG - Intergenic
1160081174 18:75728627-75728649 GCCTTCTGGATCGCTGCTGATGG - Intergenic
1167668023 19:50833918-50833940 GAGTTCTGGATCCCGGGTTCTGG + Intronic
929108460 2:38386602-38386624 GACCTCTGGGTCCCAGCCAAGGG - Intergenic
929670838 2:43875612-43875634 GACTTCTGGATATCAGCTGTGGG - Intronic
931759099 2:65400753-65400775 GAATTCTGGATTCCAGATTCAGG - Intronic
934747199 2:96767181-96767203 CACTTCTGTCTCCCAGCTCACGG + Intronic
935656658 2:105429110-105429132 AACCTCTGGATCCCAGATTCAGG - Intronic
937380914 2:121375443-121375465 AACTTCTGCATCCCAGGTTCAGG + Intronic
938049099 2:128150930-128150952 AACTTCTGCATCCCAGATTCAGG + Intronic
938828416 2:135030075-135030097 GACTTCTAGCACCCAGCTTGAGG + Intronic
940907212 2:159180027-159180049 CATTTCTGGATCCCAGCATCTGG - Intronic
941540444 2:166776367-166776389 GTTTTCTGAATTCCAGCTTATGG + Intergenic
942594026 2:177575231-177575253 GTTTTCTGGATCCCATCTTGTGG - Intergenic
946040596 2:216780195-216780217 GACTTCTTGACCCCAGTTCATGG - Intergenic
1169003040 20:2182087-2182109 GACTTCTGGGTCCCAGGTCTGGG + Intergenic
1172754143 20:37271584-37271606 GACTTCTGGCTCCAAGTTCACGG - Intergenic
1174892209 20:54407886-54407908 GTCTTCTAGATCCCAGTTTTTGG - Intergenic
1175652903 20:60743598-60743620 GTCTTCTGGATACCTGCTGAAGG - Intergenic
1175806546 20:61832237-61832259 GGGTTCTGGATCCCAGCTCAAGG + Intronic
1175994793 20:62807236-62807258 GACTCCTGGCTTCCACCTTAGGG - Intronic
1178347849 21:31847285-31847307 GACTTTTGGACTCCAGCTAACGG + Intergenic
1178824865 21:36006398-36006420 GCCTTGTGGATCCCAGCCTGGGG + Intergenic
1183894551 22:40957749-40957771 GACTGCTTGATCCCAGGTCAAGG - Intronic
950070053 3:10144592-10144614 GACTGCTTGAGCCCAGGTTAAGG - Intronic
955074790 3:55603308-55603330 GACTTCTGGATCCAAGAACAAGG - Intronic
955404069 3:58614223-58614245 GAATTTTGGATTCCTGCTTAGGG + Intronic
957384613 3:79479560-79479582 GACTTCCAGATACCAGCTTTGGG - Intronic
964381517 3:156102685-156102707 GACTTCTCTATCCCAGCTCCTGG + Intronic
964602625 3:158518585-158518607 GACTTCTGTTTCCCAGATTATGG - Intronic
968165469 3:196461170-196461192 GACTTCTGAATTCAAGCTTTAGG + Intergenic
968311572 3:197687914-197687936 GACGTCTGGATCTCAGCCTTGGG + Intronic
969393874 4:6908636-6908658 GACTTCTGGCTCCCAGCGCTGGG + Intergenic
971388313 4:26161720-26161742 GCCTCCTGGACCCCAGCTTCAGG - Intergenic
971695714 4:29900619-29900641 GATTTCTGGATCACAGATGAAGG - Intergenic
972548313 4:40103809-40103831 GACTCCTGTCTCCCAGATTAAGG - Intronic
978120365 4:105071971-105071993 GCATTCTGGATCAAAGCTTAAGG - Intergenic
978711997 4:111794359-111794381 GACTTGTAGATCCCAATTTAAGG - Intergenic
979156150 4:117392804-117392826 CAGTTCTGGATCAGAGCTTAAGG - Intergenic
984375541 4:178924164-178924186 GCCATCTTGCTCCCAGCTTAAGG - Intergenic
985004676 4:185522234-185522256 GACTTTCGGATCCCAGCCTGGGG + Intronic
987557277 5:19469835-19469857 GACTTGTAGAACCCAGCATATGG - Intergenic
992957425 5:81924316-81924338 GAGTTCTGGATCTCAGGATATGG - Intergenic
993992373 5:94675131-94675153 GCCTTCTGACTCCCAGGTTAGGG - Intronic
994337319 5:98582827-98582849 AACTTCTGGCTCCCAGTTTCTGG + Intergenic
996832859 5:127759036-127759058 GGCTTCTGGTTCCCAGCTCCAGG + Intergenic
997294226 5:132759859-132759881 GACATCTGGACTCCAGCTAAGGG + Intronic
999201941 5:149822843-149822865 GGCTCCTAGATCCCAGCTCAAGG - Intronic
999702553 5:154241251-154241273 GAATTCTGGGCCCCAGCTGAGGG + Intronic
1001214716 5:169845125-169845147 GAATTCGGGATCTCAGTTTATGG + Intronic
1005773450 6:29101662-29101684 GACATGTGGAGCCCATCTTATGG + Exonic
1005779497 6:29174355-29174377 GACATGTGGAGCCCATCTTATGG + Exonic
1006548293 6:34798301-34798323 GACTTCTGGATACCAGTTTAGGG + Intronic
1006811836 6:36825201-36825223 GATTTTTGGCTCCCACCTTAGGG - Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1012129973 6:95477878-95477900 GACTTGTGGTTCCTAGTTTAAGG - Intergenic
1012905836 6:105064496-105064518 AACATCTGGAACCCAGCTTCTGG - Intronic
1016937413 6:149457356-149457378 GACCTCTGGCTCCCAGCTAGGGG - Intronic
1017422559 6:154287746-154287768 CACTTCTGGCTCTCAGATTAGGG - Intronic
1022819960 7:33950081-33950103 GACTTCTGGAAGGCAGTTTAAGG + Intronic
1029024828 7:97405051-97405073 GATGTCTGGATCCTACCTTAAGG - Intergenic
1031127836 7:117794283-117794305 GGCTTCTGTATCCCAGCTTGGGG - Intronic
1031945436 7:127834875-127834897 GACTTCTTGATGCCAGCTCATGG + Intronic
1034495662 7:151420490-151420512 GGATTCTGAAGCCCAGCTTAAGG + Intergenic
1035391133 7:158505866-158505888 GATTACTGGATGCCTGCTTATGG - Intronic
1035514790 8:223517-223539 GACTACTTGAGCCCAGATTATGG + Intergenic
1037214812 8:16436594-16436616 CACCTTTGGATCCCAGCTTTGGG + Intronic
1038890813 8:31720954-31720976 CAGTTCTGCATCCCAGCTTCAGG - Intronic
1041785692 8:61630849-61630871 GACTTCTGGATACCTCCTGAAGG - Intronic
1043325656 8:79047762-79047784 GACTTGTGAATCCCAGCTATGGG + Intergenic
1044801186 8:95958156-95958178 TAATTCTGGTCCCCAGCTTAGGG + Intergenic
1048481504 8:134799704-134799726 GAATTTTGAATCCCAGCTTCTGG - Intergenic
1051680650 9:19604452-19604474 TACTCCTGGATCCCATCTTGTGG + Intronic
1054750272 9:68898249-68898271 GACATCTGGATGCCTGCTTTTGG - Intronic
1061338682 9:129961368-129961390 GACTTGTGGATCTGAGCTTAGGG + Intronic
1061700596 9:132412133-132412155 GATTTCTGAACCCAAGCTTAGGG + Intronic
1062105204 9:134751400-134751422 CACTTCTGGATCCCAGCAGAGGG - Intronic
1062308654 9:135923696-135923718 GACTCCTGGAGCCCAGCCTGGGG - Intergenic
1187657806 X:21498447-21498469 GACTTCTGGCCCACTGCTTATGG - Intronic
1189649244 X:43171602-43171624 GACTTCTATGGCCCAGCTTAGGG - Intergenic
1190380943 X:49839343-49839365 GAGTTCTGGTTTCCACCTTAGGG + Intergenic
1192670950 X:73140660-73140682 CACTTGTGGATCCCAGGTTGAGG + Intergenic
1195212410 X:102662048-102662070 GATTTCTGGATCTCAGCCTCAGG + Intergenic
1196059752 X:111395278-111395300 GGCCTCTGAATCCCAGCCTAGGG + Intronic
1197923280 X:131619245-131619267 GACTTATAGCTCCCAGCTGATGG - Intergenic