ID: 1116941277

View in Genome Browser
Species Human (GRCh38)
Location 14:50793314-50793336
Sequence GTGTTTCAGACTAATTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116941277 Original CRISPR GTGTTTCAGACTAATTGATG TGG (reversed) Intronic
906808180 1:48800598-48800620 CTATTTCAGACTTTTTGATGTGG + Intronic
908230662 1:62101716-62101738 GTGTTTCAGACAGACTGTTGAGG + Intronic
908822186 1:68100070-68100092 GTTTTTCTCACTAATAGATGTGG + Intronic
916415937 1:164592057-164592079 GTGTTTCTGAGTAGTTAATGTGG + Intronic
919549233 1:198963981-198964003 CTCTTTCAGACTTTTTGATGTGG + Intergenic
921569215 1:216758815-216758837 GTGATTAAGCCTAATTTATGGGG - Intronic
924917416 1:248586207-248586229 CTCTTTCAGACTTTTTGATGTGG + Intergenic
1069111501 10:64453145-64453167 GTGTTTAAGACTCATCTATGAGG - Intergenic
1074982294 10:118629502-118629524 CTGTTTCAGCCAAGTTGATGAGG + Intergenic
1085225056 11:74912198-74912220 GTGTTGCAAACTAAATAATGTGG + Intronic
1085706616 11:78792140-78792162 CTGTGTATGACTAATTGATGAGG + Intronic
1090087695 11:123665407-123665429 GTATTTCAGAATGATTAATGAGG + Intergenic
1092437197 12:8459317-8459339 GTGTTTGTGATTAATTGTTGTGG + Intronic
1092954796 12:13540009-13540031 TTGTTTCAGAATAATACATGAGG + Exonic
1094776176 12:33730659-33730681 ATTTTGCACACTAATTGATGCGG + Intergenic
1095794387 12:46201785-46201807 GTGTTGCAGATTAATTGTTTGGG - Intronic
1095829768 12:46571875-46571897 GTGTTGCTGACTGATTGATCTGG + Intergenic
1097878239 12:64663366-64663388 GTGGTGCATGCTAATTGATGGGG + Intronic
1099497922 12:83375819-83375841 ATGTTTCTAACTATTTGATGTGG + Intergenic
1102202507 12:111067394-111067416 GGGTTTCAGACAATTTCATGGGG + Intronic
1103061171 12:117859892-117859914 GTGTTTAACATTAATTAATGGGG - Intronic
1104741696 12:131180770-131180792 ATCTTTCAGACTTTTTGATGTGG - Intergenic
1105530226 13:21212394-21212416 GCGTATCAGACTTATTGAAGGGG + Intergenic
1105601797 13:21894218-21894240 CTGTTTGAGACTAATTGCTGAGG + Intergenic
1105908533 13:24837726-24837748 CTGTTTCAGTCTTTTTGATGTGG - Intronic
1106292568 13:28378620-28378642 GTTTTACAGACTAATGGATGAGG - Intronic
1107361446 13:39621999-39622021 CTCTTTCAGACTTTTTGATGTGG - Intergenic
1108109072 13:47047794-47047816 GAGTTTCAGAATAATGAATGTGG - Intergenic
1108690960 13:52858708-52858730 CAGTTTCTGACTAATTGGTGGGG + Intergenic
1109091985 13:58059072-58059094 GTGTTTGAGAATAATTTTTGAGG - Intergenic
1111563790 13:89988455-89988477 TACTTTCAGACTAATTCATGTGG + Intergenic
1115778031 14:36737648-36737670 GTGTTTAAAACAACTTGATGGGG - Intronic
1116941277 14:50793314-50793336 GTGTTTCAGACTAATTGATGTGG - Intronic
1117271606 14:54149603-54149625 CTCTTTCAGACTTTTTGATGTGG - Intergenic
1119946415 14:78699762-78699784 CTGTTTTAGAATATTTGATGAGG - Intronic
1124530894 15:30505015-30505037 GTGTTTCAGAATAAATGAAAAGG + Intergenic
1124767764 15:32502680-32502702 GTGTTTCAGAATAAATGAAAAGG - Intergenic
1130636487 15:85625893-85625915 CTATTTCAGAATCATTGATGTGG - Intronic
1133716488 16:8454304-8454326 CTCTTTCAGACTTTTTGATGTGG - Intergenic
1134805769 16:17123356-17123378 CTCTTTCAGACTTTTTGATGTGG + Intronic
1137679011 16:50322751-50322773 TTCATTCAGATTAATTGATGAGG + Intronic
1137872067 16:51959808-51959830 GTGTTTCTGAATCCTTGATGAGG + Intergenic
1137966912 16:52943995-52944017 GTGTTGCAGGCTAATATATGCGG - Intergenic
1138324509 16:56152882-56152904 GTGTATCTGACTTATTGAGGAGG - Intergenic
1140527147 16:75632392-75632414 GAGGTTCAGACTCAATGATGGGG - Intronic
1140894428 16:79312669-79312691 GGGTTACAGAATAATTGTTGTGG - Intergenic
1203065872 16_KI270728v1_random:1017111-1017133 GTGTTTCAGAAGAATGAATGTGG + Intergenic
1147918502 17:43902299-43902321 TTGTTGCAGACCACTTGATGGGG - Intronic
1156647878 18:39188569-39188591 AGGTTTCAGAATAATTGCTGAGG - Intergenic
1156902136 18:42312050-42312072 GGGTTTCATACTAAGTGTTGGGG - Intergenic
1157329872 18:46696027-46696049 CTGTTTCAGACTGAGTGATCAGG + Intronic
1162866853 19:13554535-13554557 GTGTGTCAGGCTAATGAATGTGG - Intronic
1165808779 19:38597677-38597699 GAGTTTCAGACAAAGGGATGGGG - Intronic
1168489886 19:56800031-56800053 GAGTTGGAGACTGATTGATGAGG + Intronic
925441693 2:3893056-3893078 GTTTTTCAGACTTTTTGATGCGG + Intergenic
925444399 2:3915395-3915417 TTGTTACAAACTAATTGCTGGGG - Intergenic
925697815 2:6600211-6600233 GTGTATCATACTGATTGATTGGG - Intergenic
925795461 2:7537090-7537112 CTCTTTCAGACTTTTTGATGTGG + Intergenic
927036466 2:19182562-19182584 CTCTTTCAGACTTTTTGATGTGG + Intergenic
930725685 2:54679117-54679139 GTGTTTGAAAATTATTGATGTGG - Intergenic
931136755 2:59411599-59411621 CTCTTTCAGACTTTTTGATGTGG + Intergenic
931171076 2:59804372-59804394 GTGTCCCAGAAAAATTGATGGGG + Intergenic
932215210 2:69961868-69961890 GTGTTCCAGAATAACAGATGAGG + Exonic
936888344 2:117339574-117339596 GTGTTTCTGTCTCATTGTTGAGG - Intergenic
941840126 2:170073335-170073357 TTGTCTCAAAGTAATTGATGAGG + Intronic
942877584 2:180819976-180819998 GTGGTTCAGAGTAATGGATAAGG - Intergenic
943578640 2:189659042-189659064 GTGTTTCCGGCTACTCGATGTGG + Intergenic
944931372 2:204523478-204523500 GTTTGTCAGATTAATTGAAGAGG + Intergenic
1169768086 20:9170593-9170615 ATATTTCAGGCTAAATGATGAGG - Intronic
1170237407 20:14122480-14122502 GGGTTACAGATTAACTGATGAGG - Intronic
1171107473 20:22448678-22448700 GTGTTTCTCACTTGTTGATGTGG + Intergenic
1173506811 20:43593947-43593969 GTGTTTCAGAATAATGCATATGG + Intronic
1174440209 20:50545501-50545523 CTTTTTCAGACTAATCCATGAGG - Intronic
1176654301 21:9576050-9576072 GTGTTTAAAAGTTATTGATGTGG + Intergenic
1178183702 21:30194468-30194490 GTAATTCAGTCTATTTGATGTGG - Intergenic
1181863374 22:25836378-25836400 GTGTTGCAGGTTTATTGATGAGG + Intronic
949207848 3:1461500-1461522 GTGTTTCAGACTGATTATAGTGG - Intergenic
951763987 3:26176575-26176597 CTCTTTCAGACTTTTTGATGTGG + Intergenic
952230033 3:31419993-31420015 GGGTTTCAGACTAAGGGATTTGG - Intergenic
956373312 3:68587353-68587375 GAATTTCAAAATAATTGATGGGG - Intergenic
960152826 3:114268221-114268243 TTCTTTCAGACTTTTTGATGTGG + Intergenic
961096810 3:124164110-124164132 CTGTTTCAGATTAATTTAGGCGG + Intronic
962034689 3:131639045-131639067 CTCTTTCAGACTTTTTGATGTGG - Intronic
963757607 3:149251920-149251942 GTGATTCAGAGTAATTGGAGGGG - Intergenic
964147012 3:153476065-153476087 CTCTTTCAGACTTTTTGATGTGG + Intergenic
964160899 3:153643658-153643680 CTCTTTCAGACTTTTTGATGTGG - Intergenic
964372139 3:156011464-156011486 AAGTTTCAGACTAATAGGTGTGG - Intergenic
965213971 3:165835611-165835633 TTGTTGCAGACTAAGTGAAGTGG + Intronic
970578269 4:17448632-17448654 GTGTTTTAGCCTAATTGGTTAGG + Intergenic
981666680 4:147235234-147235256 CTGTTTCAGGCAAAATGATGGGG + Intergenic
983036094 4:162867687-162867709 CTCTTTCAGACTTTTTGATGTGG - Intergenic
983289781 4:165787253-165787275 GGATTTCAGACTAATTTATTTGG - Intergenic
984790208 4:183608229-183608251 GTATTTCAGTTTAATTTATGAGG + Intergenic
987972238 5:24962209-24962231 GTTTCTAAGACTATTTGATGGGG - Intergenic
988873698 5:35419859-35419881 GTGTATCAGAGGAATTCATGTGG + Intergenic
992706983 5:79406127-79406149 GCGTTTTAAAATAATTGATGTGG - Intronic
993457213 5:88141039-88141061 GTGTTTCAGAGAAATTAATCTGG + Intergenic
996450075 5:123611071-123611093 CTGTTTCAGATTAAGTGCTGGGG + Intronic
996853434 5:127978163-127978185 GTGTTTCATACTATTTAATTAGG + Intergenic
998189575 5:140011660-140011682 GTCTTTCAGACTCATTCATGTGG - Intronic
999910861 5:156197315-156197337 GTGTTTCAAACTAATCCGTGAGG - Intronic
1000158822 5:158579339-158579361 CTCTTTCAGACTTTTTGATGTGG + Intergenic
1000939644 5:167344938-167344960 GTGTTTCAGACTCTAAGATGAGG + Intronic
1004496352 6:16166805-16166827 ATGATTCAGACTTGTTGATGAGG + Intergenic
1008012570 6:46484134-46484156 GACTTTCAGACAAATTTATGGGG + Intronic
1008150212 6:47941019-47941041 TTGTTTCAGAACAATTGATATGG - Intronic
1009994644 6:70884670-70884692 CTCTTCCAGACTCATTGATGAGG - Intronic
1012259133 6:97067424-97067446 GTATTTAATGCTAATTGATGGGG + Intronic
1013338191 6:109186744-109186766 GTGTTCCAGACTACCTGCTGTGG + Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015354397 6:132260079-132260101 TTGTTACAGACTATTTGAAGAGG - Intergenic
1016145793 6:140671495-140671517 GTCTTTCAGACTCCTAGATGAGG - Intergenic
1016915167 6:149237863-149237885 GTTTTTCAAACAAATTGATTTGG - Intronic
1020271473 7:6599144-6599166 TTGTATGAGACTAATTGCTGGGG + Intronic
1021004655 7:15379153-15379175 ATGTTTCTGACTTCTTGATGTGG - Intronic
1021965911 7:25917793-25917815 GTGTTTCAAACAAAATGATTAGG + Intergenic
1023037403 7:36144382-36144404 GTGTTTCAGCATATTTGCTGAGG - Intergenic
1024265280 7:47601591-47601613 GTGATTCACACCAATTCATGGGG + Intergenic
1025280660 7:57624718-57624740 GTGTTTAAAAGTTATTGATGTGG + Intergenic
1025304070 7:57840789-57840811 GTGTTTAAAAGTTATTGATGTGG - Intergenic
1033718783 7:144034407-144034429 GTGTTTCACTCTAGCTGATGGGG - Intergenic
1034019846 7:147629858-147629880 CTCTTTCAGACTTTTTGATGAGG - Intronic
1034255309 7:149721528-149721550 CTGTGTCAGACTCACTGATGGGG - Exonic
1035442586 7:158914815-158914837 TTGTTTCAAAATAACTGATGGGG - Intronic
1036065983 8:5381992-5382014 GTGTTTTAAACTAACAGATGAGG - Intergenic
1038070235 8:24005648-24005670 GTGTTTAAGGATAACTGATGTGG + Intergenic
1039789235 8:40861114-40861136 GAGTTTCAGACTAATCGAGGAGG - Intronic
1040442575 8:47459742-47459764 CTGTTTCAGACTTTTTGTTGTGG + Intronic
1041111987 8:54491884-54491906 GTGTTTCAGAAGCAATGATGAGG - Intergenic
1043876126 8:85488648-85488670 CTCTTTCAGACTTTTTGATGTGG + Intergenic
1043879096 8:85521346-85521368 TTGTTTCAAATTATTTGATGTGG + Intergenic
1046603763 8:116347899-116347921 GTGTTTCCCAAGAATTGATGAGG + Intergenic
1046954366 8:120047743-120047765 GTGGTTAAGACTAAATGCTGAGG + Intronic
1050237247 9:3594873-3594895 GTGCTTCTTACCAATTGATGTGG - Intergenic
1055134424 9:72811409-72811431 GTGTTTCAGAAGAGTTCATGAGG + Intronic
1057119199 9:92555996-92556018 CTCTTTCAGACTTTTTGATGTGG + Intronic
1203632022 Un_KI270750v1:79508-79530 GTGTTTAAAAGTTATTGATGTGG + Intergenic
1192461388 X:71320206-71320228 GTGTTTCAGTCTTATTAAAGAGG - Intergenic
1194287006 X:92022103-92022125 ATTTTGCACACTAATTGATGCGG - Intronic
1201894794 Y:18981922-18981944 GTTTCTCAGATAAATTGATGTGG - Intergenic