ID: 1116944127

View in Genome Browser
Species Human (GRCh38)
Location 14:50820090-50820112
Sequence GTGATAGTCCTGAGAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116944127 Original CRISPR GTGATAGTCCTGAGAGTGGG GGG (reversed) Intronic
900735184 1:4295246-4295268 TTGGTGGTCCTGAGACTGGGTGG + Intergenic
902270185 1:15298617-15298639 GTGATAGACATGATATTGGGTGG - Intronic
904029941 1:27527756-27527778 GTGGTTGTCCTGGGAGGGGGCGG - Intergenic
905237940 1:36563087-36563109 GTGGGAGTCCTGAGAGAGGAAGG - Intergenic
905475841 1:38227346-38227368 GTGGTAGTCGTGAGGGTGGCAGG - Intergenic
905634338 1:39539319-39539341 CTGAAAGTCCTGGGACTGGGCGG + Intergenic
905913036 1:41666862-41666884 GGGATAGTGCAGAGAGAGGGAGG - Intronic
907325800 1:53638027-53638049 GTTATAATCCTGAGAGAGGGAGG + Intronic
911199828 1:95033217-95033239 ATGGTAGTTCTGGGAGTGGGAGG - Intronic
914263713 1:146020161-146020183 GTGAGAGTGCTTAGAGTTGGGGG + Exonic
915593293 1:156882632-156882654 GTGATAGGGCTGAGGGTGGCGGG - Intergenic
916295685 1:163216782-163216804 GTGATGGCCCTGAGAAAGGGTGG + Intronic
919258893 1:195163224-195163246 GTGACAGTCTTGAGAGGTGGTGG + Intergenic
919704040 1:200659439-200659461 GTGACATTCCTGAGGCTGGGAGG + Intronic
921276373 1:213524691-213524713 GGGATAGTCCTGTGAGTAGGTGG - Intergenic
922887719 1:229032649-229032671 GTGATAGTTTGGAAAGTGGGAGG + Intergenic
1065976364 10:30846304-30846326 GGGCTAGTCCTGAGAGTGTCAGG + Intronic
1070144187 10:73761748-73761770 AAGATAGTCCTTAGAATGGGAGG + Intronic
1071501320 10:86206287-86206309 CTGGGAGACCTGAGAGTGGGTGG - Intronic
1072191930 10:93083024-93083046 ATGATACTGCTGAGAGTGTGTGG + Intergenic
1073294875 10:102432770-102432792 GTGAAGGTCTTGAGAGGGGGTGG + Intergenic
1076111917 10:127866371-127866393 GCGATTGTCCTGGAAGTGGGAGG - Intergenic
1076253698 10:129003173-129003195 GTGATTGTCCTGGGAATGGAGGG + Intergenic
1078098094 11:8312765-8312787 GGGTGAGTCCTGAGACTGGGAGG - Intergenic
1078619445 11:12893673-12893695 GAGATGGTGCTGGGAGTGGGAGG + Intronic
1079787318 11:24689599-24689621 CTGACATTCCTGAGACTGGGTGG + Intronic
1081873448 11:46393360-46393382 GTGATACTCCTAAGAGGAGGTGG + Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084223328 11:67698394-67698416 GTGATCCTCCAGAGAGTGGGAGG + Intergenic
1087619781 11:100528364-100528386 GGGAAAGTCCTGAGAGTGGATGG + Intergenic
1088995147 11:114989672-114989694 AGGACACTCCTGAGAGTGGGCGG - Intergenic
1089346834 11:117796463-117796485 GTGAGAGTCCCGAGAGCTGGAGG - Intronic
1091085228 11:132715138-132715160 ATGATACTCCGGAGAGAGGGAGG - Intronic
1091397875 12:164907-164929 GTGATAGTACAGAGAGTGACTGG + Intronic
1094426396 12:30321151-30321173 GTGACTCTCCTGAGAGTCGGAGG + Intergenic
1096523278 12:52195972-52195994 GTCCAAGTCCTGGGAGTGGGAGG + Intergenic
1108065695 13:46575398-46575420 GTGATAGAACTGGGCGTGGGAGG + Intronic
1115875232 14:37853931-37853953 GTGATAGTCCTGATATGGGCTGG + Intronic
1116944127 14:50820090-50820112 GTGATAGTCCTGAGAGTGGGGGG - Intronic
1118203438 14:63699322-63699344 GTGAATGTCCTGAGATTGGAGGG + Intronic
1119688879 14:76654945-76654967 GCGAAAGTCCTGAGAGTGGGAGG - Intergenic
1121228498 14:92339429-92339451 GTGACAGTCCTGAGGGTAGATGG + Intronic
1121958540 14:98237384-98237406 GTCATAGTCCTGTGTGAGGGTGG - Intergenic
1124515653 15:30365569-30365591 GTGAGAGGCCTGAGAGCTGGAGG - Intronic
1124727268 15:32165155-32165177 GTGAGAGGCCTGAGAGCTGGAGG + Intronic
1126815679 15:52450970-52450992 TTTAAACTCCTGAGAGTGGGTGG - Intronic
1128157586 15:65401593-65401615 GTGGGAGTGCAGAGAGTGGGTGG + Intronic
1128372036 15:67047477-67047499 GAGATAGACCAGTGAGTGGGTGG + Intergenic
1128894124 15:71357210-71357232 GTGATAGTCTTTAGATTTGGTGG + Intronic
1130105931 15:80928523-80928545 GTGCTGGTCCTGAGAGCGGAAGG + Intronic
1130267115 15:82416545-82416567 GTGGTAGTCATGGGAGTGGAAGG + Intergenic
1130504914 15:84530315-84530337 GTGGTAGTCATGGGAGTGGAAGG - Intergenic
1133153755 16:3857103-3857125 CTGATAGCTCTGAGAGTGGCAGG - Intronic
1136546838 16:30959211-30959233 GTGGTAGTCCTAAGAGGGTGTGG + Intronic
1136547554 16:30964290-30964312 GGCAGAGTCCTGAGAGTAGGGGG - Exonic
1139359296 16:66387659-66387681 GTGCTAGTCCTGACAGTCAGAGG - Intronic
1139615328 16:68085262-68085284 GCGATAGGCCTGTGAGGGGGCGG + Intronic
1140546021 16:75810394-75810416 GGGATAGCCCTTAGAGTAGGAGG - Intergenic
1140917946 16:79510411-79510433 GTGATAGTCCCCAGACTGCGGGG - Intergenic
1142064697 16:88054555-88054577 GTGATAGCACTGGGAGTGGTGGG - Intronic
1143325415 17:6095268-6095290 GTGGTGGTCCTGAGAGAGGGGGG + Intronic
1146817398 17:35953868-35953890 CTGACAGTGCTGAGACTGGGAGG - Intergenic
1148285932 17:46391406-46391428 CTTATAGTCCTGGGGGTGGGAGG + Intergenic
1148308094 17:46609027-46609049 CTTATAGTCCTGGGGGTGGGAGG + Intronic
1148485914 17:47990969-47990991 GGGACACTGCTGAGAGTGGGAGG + Intergenic
1149573949 17:57697984-57698006 GTGACAGCCGTGAGTGTGGGAGG - Intergenic
1150218582 17:63483576-63483598 GTGACAGTACTGGGGGTGGGTGG - Intergenic
1150355502 17:64481134-64481156 GTGGTTGTCCTAAGAGTGGGAGG - Intronic
1151946212 17:77321312-77321334 CTGAGAGGCCTGAGAGAGGGAGG + Intronic
1153517611 18:5918747-5918769 GTGAAAGACCTGAGATCGGGAGG + Intergenic
1155369086 18:25079112-25079134 GTTCTGGTCCTCAGAGTGGGTGG + Intronic
1155636671 18:27964189-27964211 GTGGTAGACCAGAGAGAGGGTGG + Intronic
1156721283 18:40073017-40073039 GTGATAGTACTAAGAGTTGAAGG - Intergenic
1156818794 18:41344421-41344443 GTGAATGTCCAGAGAGTGTGTGG - Intergenic
1158291970 18:55953437-55953459 GTGATGGCCCTGAGTATGGGAGG + Intergenic
1159352019 18:67287119-67287141 GAGAATGTCCTGAGAGTGGATGG - Intergenic
1160001787 18:75031438-75031460 TTGATAGTCTTTAGAGTGTGAGG + Intronic
1161818810 19:6516677-6516699 GTTAGAGTGCTGAGGGTGGGAGG - Intergenic
1163817362 19:19475119-19475141 GGCATAGTCCTGAGAGCAGGGGG - Intronic
1167102247 19:47410794-47410816 ATAATAGTCCTGACAGTGTGTGG + Intronic
925146169 2:1584709-1584731 GGAATTGTCCTGAAAGTGGGGGG - Intergenic
925366389 2:3314883-3314905 TTGCTGGTCCTGAGAGTGAGCGG - Intronic
926564047 2:14450622-14450644 CTGATAGACCTGAGAATGGGAGG + Intergenic
926973153 2:18486853-18486875 GTGATAGACATGAGAGTTAGGGG + Intergenic
930834802 2:55782112-55782134 TTGATATCCCTGAAAGTGGGAGG + Intergenic
931430001 2:62201731-62201753 GTTATAGTGGTGAGAGAGGGTGG - Intronic
931638754 2:64363146-64363168 GTGGAAGTTCTGACAGTGGGAGG - Intergenic
933663326 2:84945162-84945184 GGGATAGTGCAGAGGGTGGGTGG - Intergenic
935784932 2:106540498-106540520 GTGAAAGTCCTGAAAGCAGGGGG - Intergenic
935934162 2:108163708-108163730 GTTATAGTCCTTAGAGAGTGAGG - Intergenic
935959879 2:108414397-108414419 GTGATAGTGCTGTGGGTGAGGGG - Intergenic
936470942 2:112798144-112798166 GTGCGAGCCGTGAGAGTGGGTGG + Intergenic
937363150 2:121242870-121242892 GCGGGAGTCCTGAGAGTTGGGGG - Intronic
938545913 2:132331227-132331249 GTGGTAGTGCTGTGTGTGGGAGG + Intergenic
941786109 2:169500359-169500381 GTGATAGAGCAGACAGTGGGGGG - Intronic
1171874775 20:30563960-30563982 GTGGTAGTGCTGTGTGTGGGAGG + Intergenic
1173709070 20:45138779-45138801 GTGACAATCCTGGGTGTGGGTGG - Intergenic
1174595188 20:51678311-51678333 GTGGCATTCCTGAGAGTGAGGGG - Intronic
1181473413 22:23154381-23154403 GTGGAAGTCCTGAGAGAAGGGGG - Intronic
1181932156 22:26410616-26410638 TTTTTAGCCCTGAGAGTGGGAGG - Intergenic
1182098315 22:27640645-27640667 GGAATATCCCTGAGAGTGGGAGG - Intergenic
1183285565 22:36960537-36960559 ATAATAATCCTGAGAGTGAGGGG - Intergenic
1184968316 22:47997251-47997273 GTGAGTGTCCTGGGTGTGGGGGG - Intergenic
1185332344 22:50257419-50257441 CTGACAGTCCTCAGGGTGGGAGG - Intronic
951504214 3:23424020-23424042 TTGAGAGTGCTGAGAGTGAGTGG + Intronic
952727659 3:36605084-36605106 GTGGGAGTTGTGAGAGTGGGTGG - Intergenic
952776039 3:37047556-37047578 TAGATAGTCCAGAGAGTGGCTGG + Exonic
952824113 3:37510539-37510561 GGGGTAGATCTGAGAGTGGGTGG + Intronic
954318466 3:49814084-49814106 GTGTCAGACCTGAGGGTGGGAGG + Intergenic
955067309 3:55544400-55544422 GTGATAGAGCTGGGGGTGGGAGG - Intronic
955555585 3:60133596-60133618 AAGATTGTCCTGAGAGTGTGGGG + Intronic
956280121 3:67547097-67547119 GTGATAGTACTGGGAGGTGGGGG + Intronic
958464687 3:94443098-94443120 ATGATAGCTCAGAGAGTGGGAGG - Intergenic
958806311 3:98815022-98815044 GAGACAGAGCTGAGAGTGGGAGG + Intronic
964630381 3:158803076-158803098 GTGGTAGTCTTGACAGTGGTTGG + Intronic
967155313 3:186686265-186686287 GAGCTAGTGCAGAGAGTGGGTGG + Intergenic
968173161 3:196526628-196526650 GTGCTACTCCTGAGAGTGCTCGG + Intergenic
974881927 4:67769526-67769548 GAGAGAGTCATGAGGGTGGGGGG + Intergenic
977151925 4:93523367-93523389 GTAATACTCTTGAGAGTGAGTGG - Intronic
985003256 4:185506179-185506201 GTGATACTCCAGAGTGTGGGGGG + Intronic
985469015 5:26098-26120 GTGATTGTCCTTAGAGTTGGTGG - Intergenic
989011338 5:36876422-36876444 GTGGTGGTCGTGAGCGTGGGGGG - Intergenic
995396699 5:111694576-111694598 GTGATACTCCTGGGATTTGGTGG - Intronic
995691289 5:114829282-114829304 GTGAAGGTGCTGAGAATGGGTGG + Intergenic
999229659 5:150054216-150054238 GGTATAGTCCTGAGGGTGGGAGG + Exonic
1000571762 5:162923824-162923846 GTGATAGTGCTGTGGGTTGGTGG - Intergenic
1002632588 5:180591226-180591248 GAGACAGCCCTGAGAGGGGGAGG + Intronic
1002704716 5:181152734-181152756 GTGATCCTCCAGAGAGTGGAAGG - Intergenic
1012402153 6:98849560-98849582 GTGATATTCCTGGGAGGGGGTGG - Intergenic
1012701162 6:102458955-102458977 CTGATAGTGCTGAGACTGGGAGG + Intergenic
1013743624 6:113318849-113318871 CTGGTGTTCCTGAGAGTGGGTGG + Intergenic
1016311500 6:142738403-142738425 GTGACAATCCTGAGAGGAGGGGG - Intergenic
1019119430 6:169791558-169791580 GTGATTATCCTGAGATTGAGAGG - Intergenic
1019332596 7:467792-467814 GTGATAGTCGTGAGATGTGGTGG - Intergenic
1019332619 7:467951-467973 GTGATAGTCATGAGAGATGATGG - Intergenic
1019332639 7:468067-468089 GTGATAGTCATGAGAGGTGATGG - Intergenic
1019332642 7:468100-468122 GTGATAGTCATGAGAGGTGATGG - Intergenic
1019332660 7:468216-468238 GTGACAGTCATGAGAGGTGGTGG - Intergenic
1019332683 7:468415-468437 GTGATGGTCATGAGAGGTGGTGG - Intergenic
1020267577 7:6571593-6571615 ATGATACTCCCAAGAGTGGGTGG - Intergenic
1024223525 7:47305988-47306010 GTGATAGTCCTGTGAGTTGTAGG - Intronic
1024295385 7:47837603-47837625 GGGAAAGTTCTGAGAGTGGAGGG - Intronic
1025159040 7:56636950-56636972 GTGATTGTTCAGAGTGTGGGAGG - Intergenic
1025756683 7:64351146-64351168 GTGATTGTTCAGAGTGTGGGAGG + Exonic
1027503481 7:78984713-78984735 GTGATAGTGCTGAGTGTGTGTGG - Intronic
1027909474 7:84230956-84230978 GTGATACTCTTAAGATTGGGGGG - Intronic
1028724075 7:94067565-94067587 TTGAAACTCCTGAGAGTGGAGGG - Intergenic
1029063510 7:97824375-97824397 GCTATCTTCCTGAGAGTGGGAGG + Intergenic
1032830737 7:135622903-135622925 GTGATGGTCATGAGATTGGAAGG + Exonic
1034974246 7:155438739-155438761 GGGATGGCCCTGAGAGTCGGGGG - Intergenic
1035257779 7:157642948-157642970 GTGATGGTCCAGAGAGTCTGCGG - Intronic
1048376578 8:133827899-133827921 GTGATAGCCATGAGAGATGGGGG + Intergenic
1048541006 8:135342096-135342118 GAGACAGTCCTGAGAGCAGGGGG - Intergenic
1049228630 8:141470574-141470596 GTCAAAGTCCTTAGAGTGGAGGG - Intergenic
1051988446 9:23120617-23120639 GTTATAGACCTGAGAGGAGGAGG - Intergenic
1051989099 9:23129556-23129578 GTAATAGTCATGAAAGTGTGAGG + Intergenic
1060032999 9:120231767-120231789 ATGGTAGTCCTGAGAGAGGGTGG + Intergenic
1061055862 9:128222640-128222662 GAGAGAGTCCTGAGTGAGGGTGG - Intronic
1062369063 9:136227600-136227622 GGGACAGTTCTGAAAGTGGGTGG - Intronic
1202365032 Y:24154297-24154319 GTGGTAGTCATGGGAGTGGAAGG + Intergenic
1202505749 Y:25515825-25515847 GTGGTAGTCATGGGAGTGGAAGG - Intergenic