ID: 1116944194

View in Genome Browser
Species Human (GRCh38)
Location 14:50820733-50820755
Sequence TGTGACTTCTTTGCAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116944194 Original CRISPR TGTGACTTCTTTGCAAAAAC TGG (reversed) Intronic
900910695 1:5595039-5595061 TGTGTCTTCTCTGCAAAATGAGG - Intergenic
902227395 1:15005311-15005333 GGTGACTGCCTTGCAAACACTGG - Intronic
904283199 1:29435786-29435808 TGTGACTTCTTTGCACATGCTGG + Intergenic
905894549 1:41536669-41536691 TGTGGTTTCATTGAAAAAACTGG - Intronic
906106044 1:43293234-43293256 TGTGACTTCTTAGGGATAACTGG - Intergenic
906902235 1:49847542-49847564 TGTGACATTTTTGTAAAAATTGG - Intronic
906964388 1:50442269-50442291 TGTGACCTCTTTTGATAAACAGG - Intronic
908219591 1:61991625-61991647 AGTGACTTCTTTGCAGAAACAGG - Intronic
909224407 1:72998787-72998809 TGTGACTTCTTAGAAAAAACAGG + Intergenic
909444121 1:75729472-75729494 TGTGACTTCTAGCCAAAGACTGG + Intronic
911002634 1:93181283-93181305 TATGACTTCTTTCCAAAATGAGG + Intronic
911210957 1:95137510-95137532 TGTGATTCCTTTGCAAATACAGG - Intronic
912748841 1:112268637-112268659 TGTGACATGCTTGCAGAAACTGG + Intergenic
913252463 1:116923365-116923387 TGTGACTTCATTTCTAAGACAGG + Intronic
916279067 1:163028581-163028603 TGTTAGTTTTTTGCAAAACCAGG - Intergenic
916974643 1:170062907-170062929 TGTTACCTCTTTGCAAAAATGGG + Intronic
919108767 1:193190401-193190423 TTTGACTTCTCTTCAAAAAGGGG - Intronic
919994513 1:202736299-202736321 TCTGAATTCTTTGCCAAGACTGG - Exonic
920631530 1:207657793-207657815 TGTGATTTCTTTGTTTAAACGGG - Intronic
922708322 1:227805426-227805448 TGTGAATTTTTTGCAACAACTGG - Intergenic
922769104 1:228172513-228172535 TGGGACTTCTCAGCAAGAACAGG - Intronic
923701750 1:236306428-236306450 TGTGACTTCTGGGCAAGGACAGG + Intergenic
924360723 1:243239020-243239042 TGGGACTTCTTTGAAAACCCTGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924678820 1:246209801-246209823 TTTGAGTTCTTTCCAGAAACTGG - Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063173181 10:3528118-3528140 TCTGACTTCTTTCTAAAGACGGG - Intergenic
1066000483 10:31100474-31100496 ACTAACTGCTTTGCAAAAACTGG - Intergenic
1066424465 10:35293485-35293507 GCTAACTTCTTTGCAGAAACTGG - Intronic
1066600460 10:37100442-37100464 TTTGAGTTCTTTGTAAAATCTGG - Intergenic
1067468181 10:46516995-46517017 AGTGACTCCTTTGCGAAAACTGG + Intergenic
1067826684 10:49579197-49579219 TGTTACTTCATTTCAAAATCTGG - Intergenic
1067899450 10:50223671-50223693 TGTGACTTACTTGCAAATATGGG + Intronic
1068177656 10:53482602-53482624 TGAGAATACTTTGTAAAAACTGG - Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1071522144 10:86338029-86338051 TCTCACTTCTTTCCAAAACCAGG - Intronic
1071618941 10:87100886-87100908 GCTGACTTCTTTGCAGAAATTGG - Intronic
1071996603 10:91155343-91155365 TGTTTCTTTTTTGCAATAACTGG + Intergenic
1073011752 10:100365499-100365521 GGTGACTACTTTTCAGAAACAGG - Intergenic
1074703040 10:116109209-116109231 TGCGGCTTCTTTCCAAAACCTGG - Intronic
1075537703 10:123284868-123284890 TGTGACTGGTTTGGAACAACTGG - Intergenic
1076187116 10:128458646-128458668 TGTGACTGCTTTGTATAAATGGG - Intergenic
1078650169 11:13183624-13183646 TTTAATTTCTTTGCAGAAACTGG - Intergenic
1078708823 11:13770601-13770623 TGTGTCTTTTTGGCAAAAATTGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081753233 11:45527136-45527158 TGTTACTTCATTGATAAAACAGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083713499 11:64562767-64562789 TTTACCTTCTTTGGAAAAACTGG + Intronic
1084583619 11:70040436-70040458 TGTAACTTTTTTGCAATATCTGG - Intergenic
1084733906 11:71092182-71092204 TCTGACTTCTCTGGAGAAACTGG - Intronic
1093128225 12:15356348-15356370 AGTGACTTCTTTGCACAGAATGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094621926 12:32088150-32088172 TGTGATTTTTTTGAAAAAACAGG - Intergenic
1097603597 12:61725343-61725365 CGTGAATTCTTTGCATAAGCTGG + Intronic
1097897167 12:64836445-64836467 TAAGACTGCTTTGTAAAAACTGG - Intronic
1097930400 12:65177688-65177710 TGTTACTTCTTTGTAACAACTGG - Intronic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1099915962 12:88893611-88893633 TCTGGCTGCTTTGCAAAAAATGG + Intergenic
1100167721 12:91937138-91937160 TGTGACATCCTTGGAAAAAAAGG - Intergenic
1100484623 12:95013200-95013222 TGTTACTTCTTTCCGAAATCTGG + Intergenic
1101670453 12:106866825-106866847 TCTAACTTCTTTTGAAAAACTGG + Intronic
1101904771 12:108816399-108816421 TGTGAGATCATTGCAAAACCTGG - Intronic
1102269045 12:111515074-111515096 GGTGACTTCTTTGCTCAAAAGGG - Intronic
1102632413 12:114292881-114292903 TGTGGATTCTTTGCAAATAAAGG + Intergenic
1104123076 12:125817828-125817850 TCTAACTTCTCTTCAAAAACTGG - Intergenic
1104628135 12:130376775-130376797 TGTGACTACTTTGCTGAAAATGG - Intergenic
1105495257 13:20925241-20925263 AGTCATTTCTTTGCAATAACAGG - Intergenic
1105592050 13:21801280-21801302 AATGCCTTATTTGCAAAAACAGG + Intergenic
1106715718 13:32385927-32385949 TGTCAATTCTTTGGAGAAACTGG + Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107856285 13:44618367-44618389 AATGCCTCCTTTGCAAAAACAGG + Intergenic
1108846322 13:54681664-54681686 AATGACTCCTTTGCAAAAGCAGG + Intergenic
1109885670 13:68540699-68540721 TCTGTCTTCTTTGCAACAACAGG + Intergenic
1110471711 13:75866933-75866955 TGTGACTTCTTTGGGTCAACAGG + Intergenic
1113422753 13:110182933-110182955 TGTGACTTCTGTGAGAAAAGAGG - Intronic
1113715348 13:112501992-112502014 TGTTACTTATTTGCCACAACTGG + Intronic
1115794120 14:36913445-36913467 TTTGACTTTTTTGTAAAGACAGG + Intronic
1115826050 14:37278271-37278293 TTTTCCTTCTTTGCATAAACTGG - Intronic
1116692361 14:48125720-48125742 TGTGAATTCTTGGCACAACCAGG + Intergenic
1116944194 14:50820733-50820755 TGTGACTTCTTTGCAAAAACTGG - Intronic
1117154429 14:52923951-52923973 TGTGACTTATGTTCAAATACTGG + Intronic
1118149358 14:63173115-63173137 TTTAACTTCTCTGCACAAACTGG + Intergenic
1118767413 14:68919174-68919196 TCTGGCTTCTTTTGAAAAACTGG + Intronic
1118818805 14:69331410-69331432 TGGGACTTCTCTGCAGAAAAAGG - Intronic
1119231405 14:72982757-72982779 TGTTACTTCCTTCCATAAACGGG + Intronic
1119393656 14:74309421-74309443 TCTGGCTGCTTTGTAAAAACTGG - Intronic
1120262688 14:82206604-82206626 TGTGACATCTTTGTCAAAAATGG + Intergenic
1120779446 14:88473618-88473640 TGTGCCTTCTCTGGAACAACCGG - Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121547470 14:94772416-94772438 TTTGGCATCTTTGCAAGAACAGG - Intergenic
1122567068 14:102666936-102666958 AGTGACCTCTTTCCAAAAAAGGG - Intronic
1122957570 14:105078013-105078035 TGTGACTTCACTCGAAAAACGGG + Intergenic
1123122116 14:105921570-105921592 GGTGACTTCTTTGCACAGACTGG + Intronic
1123404784 15:20013135-20013157 GGTGACTTCTTTGCACAGACTGG + Intergenic
1123514115 15:21019782-21019804 GGTGACTTCTTTGCACAGACTGG + Intergenic
1124682003 15:31739957-31739979 TGTGGCTTCTTTTCTAAAAGGGG + Intronic
1129871180 15:78942730-78942752 AGTGTCCTCTTTGCTAAAACTGG - Intronic
1130087085 15:80786778-80786800 TGTGAGCTTTTTGCAAAAATGGG + Intronic
1130090281 15:80815074-80815096 ATTCACTTCTTTGGAAAAACCGG + Intronic
1130122021 15:81059014-81059036 TGTGACTAGTTTGCTACAACTGG - Intronic
1130631450 15:85573085-85573107 TGTGACTTAGTAGAAAAAACTGG + Intronic
1131229256 15:90647717-90647739 TGTGCCATCTTTTCAAACACAGG + Intergenic
1134361557 16:13535499-13535521 TGTGACTGTTTTCCAAGAACAGG - Intergenic
1134620163 16:15682316-15682338 TGTGTATTCTTTGTAAAGACCGG + Intronic
1134880792 16:17743845-17743867 TGTGAGTTCATTGCAAACTCAGG + Intergenic
1136485272 16:30567804-30567826 TGTGCCTTCTAAGTAAAAACTGG + Intergenic
1136853232 16:33631051-33631073 TGTGATTTCTTTAAAAAACCAGG - Intergenic
1137380939 16:47999078-47999100 GGTGTCTTCTTGGCAAAAAGAGG - Intergenic
1137713108 16:50580707-50580729 TCTGACTTCTTTTTAAAAATTGG + Intronic
1137758725 16:50923331-50923353 TGTGTCTTATCTGCACAAACAGG + Intergenic
1138958169 16:61996559-61996581 TCTGAAGTTTTTGCAAAAACAGG + Intronic
1140384476 16:74522583-74522605 TGTGACTTCTTTACATATTCTGG + Intronic
1141070505 16:80950284-80950306 TTTGACTTTTTTGCAACATCTGG - Intergenic
1141690548 16:85594071-85594093 TTTGACTTCTTTGCAGAAAAGGG + Intergenic
1203114829 16_KI270728v1_random:1479493-1479515 TGTGATTTCTTTAAAAAACCAGG - Intergenic
1144445632 17:15325268-15325290 GCTGACTTCTTTGTAAAAATTGG - Intronic
1145838506 17:27973654-27973676 AGTGACTTCTTTGCTGAATCAGG - Intergenic
1148429423 17:47630320-47630342 TGTGACTGGTTTGAAAAAAAGGG + Intergenic
1150223245 17:63508946-63508968 TGGGTCTTCTTTGGCAAAACGGG - Intronic
1150721188 17:67615562-67615584 AATGAATTCTTTGCACAAACAGG - Intronic
1151024209 17:70658271-70658293 TTTAAATTCTTTGCAAAGACTGG + Intergenic
1155503987 18:26515310-26515332 TGTTCCTTCTTTGCAAAAGATGG - Intronic
1156505739 18:37590514-37590536 TGTGAGTTCTATGCAACCACAGG + Intergenic
1156746949 18:40403718-40403740 TGAGACATTTTGGCAAAAACGGG - Intergenic
1158649110 18:59271118-59271140 TGTGACTTCTTTGTGACCACAGG - Intronic
1164015749 19:21254652-21254674 TGTGTATTCTTGCCAAAAACAGG - Intronic
1165161242 19:33817825-33817847 TGAGACTCCTTCTCAAAAACAGG + Intergenic
1165195411 19:34098663-34098685 AGTGACTTCCTTCCAAAAATGGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166678283 19:44752927-44752949 TGCTACTTCTCTGCAGAAACAGG - Intronic
1167829144 19:52004193-52004215 TGTGACCTCTTTCCTAAAACTGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926794118 2:16604799-16604821 CATGACTTCATTGCAAAAAATGG - Intronic
927387718 2:22555082-22555104 TGTGTCTTCTTTCACAAAACAGG + Intergenic
928042498 2:27891705-27891727 TGTGACTTCTCTAAAAAAAAAGG - Intronic
929062235 2:37934129-37934151 TTTTACTTCTTTTCAAAAAATGG + Intronic
929679389 2:43974872-43974894 TACGACTTCTTTTAAAAAACAGG + Intronic
931201833 2:60105198-60105220 TCTGACTTCTTTGTAGAAGCAGG - Intergenic
931327490 2:61241839-61241861 TTTTACTTCTTTGAAAAAATGGG + Intronic
931661288 2:64565636-64565658 TGAAACTTATTTACAAAAACAGG - Intronic
932972268 2:76558667-76558689 AGGGATTTCTTTGCAGAAACAGG + Intergenic
933457429 2:82534340-82534362 TGATACTTATTTGCTAAAACTGG - Intergenic
933995614 2:87667135-87667157 TATGACTGCATTGCAAATACTGG - Intergenic
936298243 2:111283777-111283799 TATGACTGCATTGCAAATACTGG + Intergenic
936734383 2:115422917-115422939 TGTGACTTCCTTACAAAGTCTGG + Intronic
937577255 2:123438551-123438573 TGTGACATTTTAGCAAGAACTGG - Intergenic
937778356 2:125808127-125808149 TGTGACTGCACTGCAAAAAATGG - Intergenic
938877099 2:135543494-135543516 GCTGGCTTCTTTGCAGAAACTGG - Intronic
939660450 2:144882416-144882438 TGTGACTACTTTTCAAGAATGGG + Intergenic
940347925 2:152646505-152646527 TCTGGCTTCTTTTGAAAAACTGG - Intronic
940384567 2:153055640-153055662 TGTGACTTCTTAGTTAAGACAGG - Intergenic
940670625 2:156662668-156662690 TGTGAGTTCTTTGACAAGACTGG + Intergenic
941070408 2:160948420-160948442 TGGGACTTCTGTGCAAGCACTGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941952674 2:171173125-171173147 TGTGACTACTTTGAAAACTCTGG + Intronic
942907985 2:181206578-181206600 TTTGACTTCTGTGCACACACAGG + Intergenic
943669549 2:190647620-190647642 TTTCAATTCTTTGCAAAAAGTGG - Intronic
944443368 2:199764792-199764814 TGTGACTACTCTGCACAAATAGG + Intronic
945422336 2:209654271-209654293 TGTCATATCTTTGCAAAAATAGG + Intronic
945745461 2:213715074-213715096 TGTGACTTCTTTGTAGAGACTGG + Intronic
945923164 2:215777120-215777142 TATGACTTCTCTGCAAAGACTGG - Intergenic
946662944 2:222020430-222020452 TGTGCCTTCTTTGTTATAACAGG - Intergenic
946889497 2:224260554-224260576 TGTAACTTCCTTGCTAAAACGGG - Intergenic
947393256 2:229661805-229661827 AGTGACCCCTTTGAAAAAACTGG + Intronic
948331977 2:237176647-237176669 TGAGTCTTCTATGCAACAACAGG + Intergenic
948398614 2:237666103-237666125 TGTGCCTTCCTTGGAAAAATGGG + Intronic
1169735239 20:8830798-8830820 TGTGACATCTATGCAAAATCTGG - Intronic
1170225608 20:13988679-13988701 GCTGACTTCTTTTCAAAAATTGG - Intronic
1170244763 20:14208299-14208321 TGTGACATCTTTGGATATACAGG + Intronic
1175053840 20:56179387-56179409 TGTGGCCACTTTGCAAAAAAAGG - Intergenic
1177230182 21:18309527-18309549 TGTTACTTCTTTGTAGATACTGG - Intronic
1177459617 21:21394017-21394039 TGTGACTTCTTAGCACATACTGG - Intronic
1177752501 21:25302602-25302624 TTTGTGTTCTTTCCAAAAACAGG - Intergenic
1178011337 21:28290215-28290237 CGTGACTTCTGTGCACACACAGG + Intergenic
1179588600 21:42390126-42390148 TGAGACTTCTCTGCAAAGAGGGG - Intronic
1179621531 21:42619659-42619681 TGTGACTACACTGCAGAAACGGG + Intergenic
1180939884 22:19653195-19653217 CCTGACTTCTTTGCAGAAATGGG + Intergenic
1183112415 22:35660075-35660097 TGTGACCTCTTTGTTAAAACTGG - Exonic
1184426743 22:44413228-44413250 TGTGGCTTCTTTACAGAAAGGGG - Intergenic
949635240 3:5975064-5975086 AGTGAGTTCTTTGCAAGATCTGG + Intergenic
949910016 3:8895850-8895872 TGTGACCTCTTTTCTAAAAGGGG - Intronic
951563813 3:23993114-23993136 TGTGACTTCTTTGAGAACTCAGG + Intergenic
951659576 3:25047677-25047699 GTTTACTTATTTGCAAAAACAGG - Intergenic
952152736 3:30610068-30610090 TCTGATATCATTGCAAAAACTGG + Intronic
952366088 3:32676064-32676086 TGTTACTGCTTTGGAAAAAGGGG + Intergenic
952502027 3:33972071-33972093 TATGGCTTATGTGCAAAAACTGG + Intergenic
952998492 3:38908296-38908318 TGCAATTTCTGTGCAAAAACAGG - Intronic
953126986 3:40100526-40100548 ATTGACTGCTTTACAAAAACAGG + Intronic
954376737 3:50198405-50198427 TGAGACTTCATTTCAAAAAAAGG - Intergenic
955940641 3:64144150-64144172 TTTAACTTCTCTGGAAAAACTGG + Intronic
956178517 3:66496968-66496990 TACCACTTCTTTGCCAAAACTGG + Intronic
957773382 3:84722932-84722954 TGTTTCTTCTTTGAAAAAAATGG - Intergenic
957816101 3:85299388-85299410 TGTCAGTTCTTTGCATAAAAAGG + Intronic
958664394 3:97116131-97116153 TGTGTCTTCTTTTAAAACACTGG + Intronic
959157247 3:102681956-102681978 TCTGACACCTTTGCAAAATCTGG + Intergenic
959887024 3:111514831-111514853 TGAGGGTTCTGTGCAAAAACAGG - Intronic
960181079 3:114579642-114579664 ATTTACTTCTTTACAAAAACTGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962553449 3:136521503-136521525 TATAACTGCTTTGCAAAAAAGGG - Intronic
964667906 3:159193901-159193923 TGTGACTGTTGTGCCAAAACTGG + Intronic
965243832 3:166239614-166239636 TCTGAGTTCTCTGCCAAAACTGG + Intergenic
966691766 3:182748794-182748816 TGAGACTTCTTCTCAAAAAAAGG + Intergenic
967588915 3:191248773-191248795 TTTGAATTCTTTGCAGAAATGGG - Intronic
968219525 3:196925992-196926014 TGTCAATTCTTTGGAAATACAGG - Intronic
969872305 4:10112198-10112220 TATGACCTCTGTGCAAAGACTGG - Intronic
969986240 4:11213976-11213998 ATTGAGTTCTTTCCAAAAACTGG + Intergenic
970977551 4:22058406-22058428 TGTGGGGTCTTTGCAAACACTGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972414823 4:38828249-38828271 TATGCCTTCTTTGGAAATACTGG - Exonic
972536485 4:40004213-40004235 TGTCCCTGCTTTGCAACAACTGG + Intergenic
974074074 4:57152952-57152974 TGTTAATTTTTTGCAAAGACAGG - Intergenic
976657096 4:87500186-87500208 TCTGACCTCTTAGCAACAACAGG + Intronic
977734029 4:100390531-100390553 TGAGACTTCTTTCCAATAGCTGG - Intergenic
977961445 4:103089650-103089672 TGAGACTCATTTGCAAAACCAGG - Intronic
977982674 4:103343682-103343704 GGTGGCTGCTTTGCAAAAATAGG - Intergenic
978052110 4:104214191-104214213 TGGGACTACTTTGAAAAGACTGG - Intergenic
978213167 4:106162622-106162644 TTTGACTTCTATGCACCAACAGG + Intronic
978996089 4:115155050-115155072 TGTGACTTCTGTGCAGAGAATGG - Intergenic
980437435 4:132795932-132795954 TTTGAGTTCTTTGTAAAACCGGG - Intergenic
981328440 4:143479214-143479236 TGTTAGTTATATGCAAAAACAGG - Intergenic
981828027 4:148967166-148967188 GGTAAGTTCTTTCCAAAAACTGG - Intergenic
981877592 4:149567176-149567198 TGTGACTTATTTGCAAAGTTTGG + Intergenic
982359803 4:154507224-154507246 TGATACTGCTTTGCAAAAACAGG + Intergenic
982425109 4:155248966-155248988 AATGACTTCTTTGCAACTACAGG - Intergenic
985143062 4:186863033-186863055 TGTGACTTCTGAACAGAAACAGG + Intergenic
985824695 5:2183607-2183629 TGTTTCTTCTTTGCAAACAGAGG + Intergenic
986125827 5:4881696-4881718 TGTGACTACTTTGAAAATGCAGG + Intergenic
987170750 5:15254989-15255011 TTTGGCTTCTTTTGAAAAACTGG - Intergenic
988038777 5:25861305-25861327 TCTGACTTCTTTGCAGCCACAGG + Intergenic
989065011 5:37451631-37451653 TGTGACTTAAGTTCAAAAACAGG + Intronic
989259308 5:39401402-39401424 TCTGACTTGGTTCCAAAAACAGG - Intronic
990090292 5:52037496-52037518 TGTAAGTTTTTTGTAAAAACGGG - Intronic
990907256 5:60817959-60817981 TGAGACTTGTTTAAAAAAACTGG + Intronic
993825985 5:92687348-92687370 TGTGCCTTCTTTGTAGAATCTGG + Intergenic
993913306 5:93710310-93710332 TTTAACTTCTTTGGGAAAACCGG + Intronic
994418820 5:99507443-99507465 TGTGACTTAAGTTCAAAAACAGG + Intergenic
995431793 5:112087581-112087603 TGTCACTTCTGTGCCAAGACAGG - Intergenic
996689648 5:126326327-126326349 TGTGTTTTCTTTACAAAGACGGG - Intergenic
997083436 5:130767739-130767761 TGTGACTTCTCTGTAAAACAAGG - Intergenic
997279595 5:132631434-132631456 TATGATTTCTTTGTGAAAACTGG - Intronic
999466226 5:151808479-151808501 TGTGACTTGTTTGAAAACATTGG + Exonic
999937202 5:156500460-156500482 TGAGACTTGTTTGTTAAAACAGG + Intronic
1000916480 5:167088230-167088252 TGTGATTTATTTCCAAATACAGG - Intergenic
1002491375 5:179580177-179580199 TTTGATTTGTTTACAAAAACGGG - Intronic
1004356878 6:14937362-14937384 TTTGAGTTCTTTGTAAAAACTGG + Intergenic
1004612192 6:17253370-17253392 TTTGAATTCTTTGCAAATGCTGG - Intergenic
1005702965 6:28421903-28421925 TATGACATCTTTGAGAAAACTGG + Intergenic
1007558553 6:42786369-42786391 AGTGACTTCCCTTCAAAAACTGG - Intronic
1011272112 6:85590341-85590363 TGTGACATTTTTTCCAAAACAGG + Intronic
1011356769 6:86479399-86479421 GGTGACTTCCTTGCAAGTACCGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1017856216 6:158351425-158351447 TTTGATTAATTTGCAAAAACGGG - Intronic
1018889655 6:167974587-167974609 TGTGACTTTTTGGAATAAACTGG + Intergenic
1018965240 6:168480191-168480213 TGTAACTTCTTGTTAAAAACTGG - Intronic
1018990836 6:168672309-168672331 TGTGTCTTTGTTGCAAAAGCTGG + Intronic
1020251803 7:6475098-6475120 GGTGACTTCTTTGCTAAGAGCGG + Intronic
1020621298 7:10522784-10522806 TGTAACTTCTTTGAAATAAATGG + Intergenic
1022063651 7:26827658-26827680 TGTGATGTCTTGGGAAAAACTGG - Intronic
1023018744 7:35990583-35990605 GCTGGCTTCTTTGCAAAAATGGG + Intergenic
1024563734 7:50664820-50664842 TGTGACTCATTTGAAAAGACAGG - Intronic
1024608182 7:51039868-51039890 TCTGGCTTCTCTTCAAAAACTGG + Intronic
1027344085 7:77239191-77239213 TGTCCTTTCTATGCAAAAACAGG + Intronic
1027672782 7:81122823-81122845 TGTGACTTAAATGCAAAAAAAGG - Intergenic
1028820216 7:95200701-95200723 TCTGATTACTTTACAAAAACAGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031201905 7:118699155-118699177 TGTGACATATTTGCAAAAGCAGG - Intergenic
1031211224 7:118829134-118829156 TCTGACTTCTTTGCAACACAAGG + Intergenic
1031599946 7:123694753-123694775 TATGACTTTATTGAAAAAACAGG - Exonic
1033723459 7:144086328-144086350 TCTCACTTCTTTGCATAAGCAGG + Intergenic
1034445110 7:151110126-151110148 TGTGACTTCTCTCAAAAGACTGG + Intronic
1036110085 8:5889203-5889225 TGCCACTTCTTTGCAAATATAGG - Intergenic
1037310485 8:17550413-17550435 TTTGACTGCATTGCAACAACTGG + Exonic
1038184401 8:25259799-25259821 TGTGAGTTCTTTCCAATATCTGG + Intronic
1038542310 8:28400270-28400292 TGTCACTTGTCTCCAAAAACAGG - Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039563424 8:38531112-38531134 TGTGAATTCTTTCTTAAAACCGG - Intergenic
1040427692 8:47305255-47305277 AGTGACTCCTATGCAAATACAGG + Intronic
1041944037 8:63421966-63421988 TGTGACATTTTTGAAAAGACAGG - Intergenic
1042521600 8:69717616-69717638 ACTGGCTTCTTTGCAAAAATTGG - Intronic
1042994253 8:74677726-74677748 TTTGCCTTCTTTTCAAATACTGG - Intronic
1043230556 8:77795022-77795044 GCTGAGTTCTTTGCTAAAACTGG - Intergenic
1044870081 8:96610941-96610963 TGTAAGTTATTTGCAAAAGCAGG - Exonic
1044874026 8:96646418-96646440 TCTGACTTGTTTGTAAAACCAGG + Intronic
1046299219 8:112264236-112264258 TGTGACATTTTTGAAAACACAGG + Intronic
1046979144 8:120317658-120317680 TGTGAGTTCTTTGCCAAGATTGG - Intronic
1050129376 9:2395654-2395676 TGTGATTTCTTTGGACAACCTGG + Intergenic
1050779801 9:9318489-9318511 TTTGGTTTCTTTGCACAAACTGG - Intronic
1051096178 9:13468019-13468041 GGTGTCTTCTTTGCAGAAATTGG + Intergenic
1051196584 9:14568335-14568357 TGTGATTTTTTTTAAAAAACAGG - Intergenic
1052365600 9:27608843-27608865 TATGACTTCTTTGGATAAAGTGG - Intergenic
1054755708 9:68955627-68955649 TGGCACTTCTTTGCCAAAACAGG + Intronic
1054829536 9:69608181-69608203 TGTGATTTCTTTGCCAAATATGG - Intronic
1055551569 9:77436442-77436464 TATTTCTTGTTTGCAAAAACAGG + Intronic
1057345222 9:94244618-94244640 TGTGAATTCTTTGAAACAAATGG + Intergenic
1058021333 9:100092671-100092693 TGTGTCTTCTTTTCAAAAAATGG - Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059778143 9:117497525-117497547 TGTGATTTCTTGTTAAAAACTGG + Intergenic
1060330307 9:122662287-122662309 TGTGATTTCTTTGACAAAATGGG - Exonic
1060791986 9:126491818-126491840 TGAGGCTTCTTTTCAAATACAGG + Intronic
1061586408 9:131571992-131572014 AGTGACATCTTTACAAAAATTGG + Intergenic
1185492287 X:526815-526837 TCTGACATCTTTGCAGAAAACGG + Intergenic
1186773859 X:12844793-12844815 CATGACATCTTTGCAAAAATAGG - Intergenic
1186894616 X:13993351-13993373 TGTGAGATATTTGCAAACACTGG + Intergenic
1187228848 X:17401516-17401538 TGTGACTACTTACCACAAACTGG + Intronic
1188284204 X:28307672-28307694 TGTTTCTTCTTTTCTAAAACAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192413470 X:70955548-70955570 ATTGGCTTCTTTGCAGAAACTGG + Intergenic
1193413782 X:81197218-81197240 AGTGATTTCTCTGCAGAAACAGG + Intronic
1194246651 X:91520508-91520530 AGTGAATTCTTTGCATAAATAGG - Intergenic
1194886118 X:99318251-99318273 TTTGACTTCTTTGAAACCACAGG - Intergenic
1195305548 X:103579312-103579334 TCTGGCTTCTTTGCAGAAATTGG - Intronic
1196474823 X:116069980-116070002 TGTAACTTCTTAGGAAAAAGGGG - Intergenic
1197319879 X:125015200-125015222 TGGGACTTATTTGCTAAATCTGG - Intergenic
1197400577 X:125984177-125984199 TGAGACTTCTTTACAAATAAGGG + Intergenic
1197581893 X:128294269-128294291 TGTGACTTCTGTGCACCCACAGG - Intergenic
1197779986 X:130150020-130150042 TGTGAGTACTTAGCAAAAGCCGG - Intronic
1198016740 X:132619113-132619135 GGTGTTTTCTTTGCTAAAACTGG - Intergenic
1199154625 X:144532927-144532949 AGTGACTTTTTTCCAAAAAGTGG + Intergenic
1200411271 Y:2864352-2864374 TGTGTCTTCTTTAAAAAAAGAGG + Intronic
1200565609 Y:4761750-4761772 AGTGAATTCTTTGCATAAATAGG - Intergenic
1200910128 Y:8524502-8524524 TCTGACTTCTTTCCCAAAAGAGG - Intergenic
1202039935 Y:20671458-20671480 TGAGATTTTTTTGAAAAAACAGG - Intergenic