ID: 1116946092

View in Genome Browser
Species Human (GRCh38)
Location 14:50836631-50836653
Sequence TCCTTTAACCATAATGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116946092_1116946095 -5 Left 1116946092 14:50836631-50836653 CCAACTCCATTATGGTTAAAGGA No data
Right 1116946095 14:50836649-50836671 AAGGAAAGCTGTGTTCAGGAAGG No data
1116946092_1116946096 13 Left 1116946092 14:50836631-50836653 CCAACTCCATTATGGTTAAAGGA No data
Right 1116946096 14:50836667-50836689 GAAGGTCTGCTGCCCCGCTCAGG No data
1116946092_1116946098 25 Left 1116946092 14:50836631-50836653 CCAACTCCATTATGGTTAAAGGA No data
Right 1116946098 14:50836679-50836701 CCCCGCTCAGGATCACACAGTGG No data
1116946092_1116946094 -9 Left 1116946092 14:50836631-50836653 CCAACTCCATTATGGTTAAAGGA No data
Right 1116946094 14:50836645-50836667 GTTAAAGGAAAGCTGTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116946092 Original CRISPR TCCTTTAACCATAATGGAGT TGG (reversed) Intergenic
No off target data available for this crispr