ID: 1116947300

View in Genome Browser
Species Human (GRCh38)
Location 14:50847750-50847772
Sequence TTGGAGAATTGGTTGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116947300_1116947308 25 Left 1116947300 14:50847750-50847772 CCCACCAACAACCAATTCTCCAA No data
Right 1116947308 14:50847798-50847820 AGGTCAATTCTGCCACTAACTGG No data
1116947300_1116947306 5 Left 1116947300 14:50847750-50847772 CCCACCAACAACCAATTCTCCAA No data
Right 1116947306 14:50847778-50847800 AGCTGAGTGTCCTACAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116947300 Original CRISPR TTGGAGAATTGGTTGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr