ID: 1116947306

View in Genome Browser
Species Human (GRCh38)
Location 14:50847778-50847800
Sequence AGCTGAGTGTCCTACAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116947299_1116947306 6 Left 1116947299 14:50847749-50847771 CCCCACCAACAACCAATTCTCCA 0: 5
1: 16
2: 24
3: 63
4: 334
Right 1116947306 14:50847778-50847800 AGCTGAGTGTCCTACAATTCAGG No data
1116947301_1116947306 4 Left 1116947301 14:50847751-50847773 CCACCAACAACCAATTCTCCAAA No data
Right 1116947306 14:50847778-50847800 AGCTGAGTGTCCTACAATTCAGG No data
1116947302_1116947306 1 Left 1116947302 14:50847754-50847776 CCAACAACCAATTCTCCAAATAC No data
Right 1116947306 14:50847778-50847800 AGCTGAGTGTCCTACAATTCAGG No data
1116947303_1116947306 -6 Left 1116947303 14:50847761-50847783 CCAATTCTCCAAATACCAGCTGA No data
Right 1116947306 14:50847778-50847800 AGCTGAGTGTCCTACAATTCAGG No data
1116947300_1116947306 5 Left 1116947300 14:50847750-50847772 CCCACCAACAACCAATTCTCCAA No data
Right 1116947306 14:50847778-50847800 AGCTGAGTGTCCTACAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116947306 Original CRISPR AGCTGAGTGTCCTACAATTC AGG Intergenic
No off target data available for this crispr