ID: 1116951147

View in Genome Browser
Species Human (GRCh38)
Location 14:50879775-50879797
Sequence CAGGCAGCAGTGCCTATATT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116951144_1116951147 23 Left 1116951144 14:50879729-50879751 CCTTGGTTTGGTGAGTCAGCTAT 0: 1
1: 0
2: 1
3: 15
4: 101
Right 1116951147 14:50879775-50879797 CAGGCAGCAGTGCCTATATTCGG 0: 1
1: 0
2: 1
3: 13
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116951147 Original CRISPR CAGGCAGCAGTGCCTATATT CGG Intronic
900178094 1:1299495-1299517 CAGGCAGGAGTGGCTATTTTGGG - Intronic
902445319 1:16459578-16459600 CAGGCAGCAGTGTTTATCTCTGG + Exonic
904017189 1:27431159-27431181 GTGGCAGCTGTGCCTATCTTTGG + Intronic
906294972 1:44644158-44644180 CAGGCAGCTGTTCAAATATTTGG - Intronic
906892035 1:49727630-49727652 AAGGCAGCAGTTCTTGTATTTGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
908365573 1:63420125-63420147 CAGGCAGTATTGCTTTTATTAGG + Intronic
910013078 1:82489476-82489498 GAGGCAAAACTGCCTATATTTGG + Intergenic
911878598 1:103203264-103203286 TATGCAGCAGTGCCTTTTTTAGG - Intergenic
913322911 1:117601892-117601914 AAGTCAGCACTGCTTATATTTGG + Intergenic
915850559 1:159317320-159317342 CATGCAGCAGTGCATGGATTTGG - Intergenic
916459519 1:165008932-165008954 CAGGCAGGTGTTCCTATATACGG - Intergenic
917681399 1:177371887-177371909 CAGGCAGCACTTCCAATAGTGGG + Intergenic
919489279 1:198185670-198185692 CAGGCAGCACTACCTATAGATGG - Intronic
919849052 1:201660177-201660199 AAGGCAGCAGAGCCTATTTGGGG + Intronic
919888085 1:201949664-201949686 CAGGGAGCAGTGAATATTTTTGG - Intergenic
919977784 1:202623756-202623778 CAGAAAGCAGTGCCTCTCTTGGG - Intronic
920182947 1:204143672-204143694 CAGGCAGCAGTCCCAATATCAGG - Intronic
924207676 1:241730294-241730316 CAGGAAGCAGTCCCTATATAAGG + Intronic
924315652 1:242792635-242792657 CAGGCAACAGTGCCTATATGAGG - Intergenic
1070138706 10:73719757-73719779 CTGGCAGCAGTGCCCATGCTGGG + Intergenic
1079922006 11:26444510-26444532 CAGGCCTCAGTGCCTACATAAGG + Intronic
1080663976 11:34319492-34319514 CAGACAGCACTGCATATACTTGG - Intronic
1081968402 11:47183135-47183157 CTGACAGCAGTTGCTATATTGGG - Intronic
1085403832 11:76250065-76250087 CAGGCAGCAGTGTCTGGATAAGG + Intergenic
1085607879 11:77919184-77919206 CTGGCAGCTGTGGCTGTATTGGG - Intronic
1087004162 11:93452741-93452763 CAGGTAGCAGTGTGTGTATTAGG + Intergenic
1089978288 11:122751598-122751620 CAGGCAGCATTGCCTGTGTGAGG - Intronic
1096505272 12:52088594-52088616 CAGGCAGAAGGGACCATATTTGG - Intergenic
1096790040 12:54038890-54038912 CAGGGTGCAGTGCTCATATTGGG - Intronic
1099348562 12:81535126-81535148 TAGGCAAAATTGCCTATATTGGG + Intronic
1102180895 12:110911481-110911503 TAGTCAGCAGTGCCGATCTTTGG + Intronic
1103174186 12:118847644-118847666 CAGGCAGCAGTGACTGTGTAGGG + Intergenic
1105633919 13:22199155-22199177 CAGGCTGCAGTGCCTGTATCCGG + Intergenic
1107911068 13:45106336-45106358 CTGGCAGCAGTGCCCAGGTTGGG + Intergenic
1112135685 13:96575351-96575373 CTGGTAGCAGTGCCTATAGTTGG + Intronic
1113139255 13:107128741-107128763 CAGGCACCACTGCCAATACTGGG - Intergenic
1113584230 13:111452416-111452438 TAGGCAGCAGTGCCCATTGTAGG - Intergenic
1116951147 14:50879775-50879797 CAGGCAGCAGTGCCTATATTCGG + Intronic
1120843782 14:89108895-89108917 CAGGGAGCAGGGCCTACACTTGG - Intergenic
1124493429 15:30172123-30172145 CAGAAAGCAGTGCCTCTCTTGGG - Intergenic
1124750105 15:32366202-32366224 CAGAAAGCAGTGCCTCTCTTGGG + Intergenic
1125171965 15:36775500-36775522 CAGGCAGCAGTGCCTATGACAGG + Intronic
1127664174 15:61128776-61128798 CAGGATGCATTGCCAATATTTGG - Intronic
1128411232 15:67400417-67400439 CTGCCAGCAGTGCCTTTCTTGGG + Intronic
1131377255 15:91935746-91935768 CAGGTATCTGTGCCTATATGTGG + Intronic
1140511029 16:75508669-75508691 GAGGGAGCAGTGCCTGTATCTGG + Intergenic
1141836722 16:86545535-86545557 CAGGCAGCAGGCCCTTTACTAGG - Intronic
1147883672 17:43670157-43670179 GAGGCAGCAGTGCCATTATTTGG + Intergenic
1148496848 17:48058200-48058222 CATGCAGCTGTGCCTCTGTTGGG + Intronic
1148858478 17:50591900-50591922 CAGGAATCAGGGCCTATACTAGG - Intronic
1149636099 17:58170538-58170560 CAGGCAGCAGTGAGAAGATTAGG + Exonic
1151920431 17:77150670-77150692 CGGGCAGCTGTGCCCATGTTGGG + Intronic
1153949575 18:10046673-10046695 CAGGCAGCAGTGACTGTCTGTGG + Intergenic
1156216610 18:35005121-35005143 CAAGGAGCAGTGCCTCTAGTGGG - Intronic
1156622710 18:38872195-38872217 CAGGCAGCAGTCCCCTCATTTGG - Intergenic
1159685447 18:71413527-71413549 CAGGCACTTCTGCCTATATTTGG - Intergenic
1163795749 19:19337228-19337250 CAGGCGGCAGTGCCAATATGGGG - Exonic
926010468 2:9402260-9402282 CAGGCAGCACTGCCTTCATTTGG + Intronic
926814615 2:16787945-16787967 CAGGTAGCAGTGTCTATTTTGGG + Intergenic
930930387 2:56875079-56875101 CAGGCAGCAGTGGCATGATTGGG - Intergenic
933394691 2:81716045-81716067 CAGTTAGAAGTGACTATATTAGG - Intergenic
934664735 2:96162393-96162415 AAGGCAGCATTGTCTGTATTGGG + Intergenic
937289453 2:120773452-120773474 CAGGCTGCAGTGCCTGAATGAGG - Intronic
938015546 2:127864216-127864238 CTGGTAGCAGTGCCTATAGCTGG - Exonic
942403963 2:175633414-175633436 CGGGGAGCAGTGCCTATCCTAGG - Intergenic
942987506 2:182160820-182160842 CTGGCATCAGTGTCTGTATTAGG - Intronic
944123488 2:196267108-196267130 CAGGCACCAGTGATTATTTTTGG - Intronic
946306065 2:218857705-218857727 GAGGCAGCAGGGACTAGATTTGG + Intergenic
1169327872 20:4690332-4690354 AAGGCTTTAGTGCCTATATTTGG + Intronic
1174175388 20:48641274-48641296 CAGGCAACAGTGCCTAACTGCGG + Intronic
1184196120 22:42929887-42929909 CAGGCAGCAGAGCTGACATTTGG - Intronic
1184825977 22:46951367-46951389 CGGGCAGCAGTGTCTAATTTTGG + Intronic
1185044134 22:48520535-48520557 CACCCAGCAGTGCCTTTGTTGGG + Intronic
949696792 3:6706465-6706487 CATGCAGCAGTGCCTGGAATAGG + Intergenic
953270893 3:41443397-41443419 CAGGCAGCAAAGCATATAGTTGG - Intronic
953378809 3:42451021-42451043 CAGCCAGCAGTGTCTACATTAGG + Intergenic
956770930 3:72525429-72525451 CAGGCAGCAGAGGCTAAATAAGG - Intergenic
958826182 3:99034351-99034373 CAGACACCAGTGCCTACTTTAGG + Intergenic
959814966 3:110664453-110664475 CAGTTAGAAGTGTCTATATTTGG - Intergenic
961706961 3:128794476-128794498 CTGACAGCAGTGCCTATAGTGGG - Intronic
967133786 3:186496285-186496307 CATGCACCAGTGCCTACATGGGG - Intergenic
977533346 4:98226299-98226321 CAGCCACCAGTGCCTATTCTTGG - Intergenic
978627613 4:110704887-110704909 AAGTCAGCAGTGCCAAGATTGGG + Intergenic
980917217 4:139044918-139044940 TAGTCAACAGTGCCAATATTAGG + Exonic
985034566 4:185825016-185825038 TAAGAAGCAGTGCCTGTATTTGG - Intronic
986771069 5:10974162-10974184 CTCTCTGCAGTGCCTATATTAGG - Intronic
994173834 5:96688571-96688593 CAGGCAAAAATGCTTATATTAGG + Intronic
994589346 5:101754479-101754501 TGGGCACCAGTGCCTAGATTAGG - Intergenic
1000023432 5:157338608-157338630 CAGGCAAAATTGCCAATATTTGG + Intronic
1000646844 5:163769708-163769730 CAGGCCGCAATTCCTATACTGGG + Intergenic
1003075611 6:2981398-2981420 CAGGGAGCAAAGCCAATATTAGG - Intergenic
1003576406 6:7300419-7300441 AAGGCATCAGAGCTTATATTAGG + Intronic
1006258211 6:32847928-32847950 CAGGTAGCGGTGCTCATATTGGG + Exonic
1007502320 6:42307770-42307792 CCTGCAGCAGTGCCTTTGTTGGG - Intronic
1009790704 6:68398552-68398574 CAGGCAGGAGAGCTTATACTTGG + Intergenic
1012496765 6:99842282-99842304 CACTCAGCAGTTCCTACATTAGG + Intergenic
1014697037 6:124635631-124635653 CATGCAGGAGTTGCTATATTTGG + Intronic
1017645584 6:156537131-156537153 CAGGCCCCACTGCCAATATTGGG + Intergenic
1025845073 7:65188747-65188769 CTGGCAGCTGTGGCTGTATTGGG + Intergenic
1025895349 7:65694775-65694797 CTGGCAGCTGTGGCTGTATTGGG + Intergenic
1026308944 7:69167199-69167221 CAGGCACCATTGCCAACATTCGG + Intergenic
1029162507 7:98562751-98562773 GAAGCAGCAGAGCCTCTATTTGG + Intergenic
1029901353 7:104043682-104043704 GACCCAGCAGTGCCTTTATTAGG + Intergenic
1031801756 7:126255550-126255572 CAGACAGCAATCCCAATATTGGG + Intergenic
1032394827 7:131581803-131581825 CAGGCAGCAATGGCTTTTTTTGG + Intergenic
1032767726 7:135015113-135015135 CAAGAAGAAGTGCCTATATCAGG + Intronic
1035672345 8:1429011-1429033 CAGACAGCAGTTCATAAATTGGG + Intergenic
1037103995 8:15082325-15082347 CAGGCAGCATGGTCTATATTAGG + Intronic
1038196594 8:25373841-25373863 CAGGAAGGAGTGCCTATGTGAGG + Intronic
1041334402 8:56763875-56763897 CAGGCAGGACTGTGTATATTTGG - Intergenic
1043132172 8:76474948-76474970 CAGGCAGCACTGCAGAGATTGGG - Intergenic
1046581424 8:116097580-116097602 CAAGCAGCAGTGCGTGTACTTGG - Intergenic
1047057856 8:121187310-121187332 AAGGCAGCAGTGCCAAGATATGG - Intergenic
1053416583 9:37950645-37950667 CAGGCAGCAGAGCCACCATTCGG - Intronic
1055771095 9:79717835-79717857 GAGGCAGCTGGGCCTATCTTGGG - Intronic
1055960778 9:81818259-81818281 CGGCCAGCAGAGCCTATATAAGG - Intergenic
1058294154 9:103284447-103284469 CAGGAAACAGTGCCCAGATTCGG - Intergenic
1186313259 X:8342752-8342774 CAGGCAGCAGGCCCTGTACTAGG + Intergenic
1186886441 X:13918900-13918922 CAGGCAGCATTGCCAATGCTGGG + Intronic
1187479207 X:19639611-19639633 CAGACAGCAATGTCTGTATTGGG + Intronic
1188721714 X:33530118-33530140 CAGACACCAGGGCCTATATGAGG - Intergenic
1192599832 X:72450264-72450286 AAGGCAGCAGTGGCTATAAAAGG + Intronic
1195561068 X:106284513-106284535 AAGGAAGCTGGGCCTATATTTGG + Intergenic