ID: 1116956690

View in Genome Browser
Species Human (GRCh38)
Location 14:50931169-50931191
Sequence TAGAATACTGAATATGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116956688_1116956690 16 Left 1116956688 14:50931130-50931152 CCATAGCATATTAAAGAAGGCAA 0: 1
1: 0
2: 0
3: 17
4: 240
Right 1116956690 14:50931169-50931191 TAGAATACTGAATATGGTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116956690 Original CRISPR TAGAATACTGAATATGGTCC TGG Intronic
902127558 1:14228928-14228950 TAACATACTGAGTATGGTTCTGG - Intergenic
902207702 1:14881535-14881557 TAGAATACTGATTATGTGCTAGG + Intronic
903214562 1:21836616-21836638 TATAAGACTGAATGAGGTCCAGG - Intronic
903405958 1:23096399-23096421 TAGAATACAGAATAGGGAACAGG + Intronic
904631230 1:31843794-31843816 TGGAATTCTGAGTATGGCCCAGG - Intergenic
905281860 1:36854370-36854392 TAAAATACTGAGAACGGTCCCGG + Intronic
909611744 1:77558097-77558119 TAAAATACTGAAGATCATCCTGG + Intronic
909898389 1:81102958-81102980 TAGAATACTGAATCTAGGCTTGG - Intergenic
910373170 1:86540210-86540232 TAGAAAAATGAGTATGGTCAAGG + Intergenic
910444309 1:87284902-87284924 TGGAATACAGAATCTGGTCATGG - Intergenic
913486554 1:119336967-119336989 TAGTGTCCTGGATATGGTCCAGG - Intergenic
916277696 1:163012971-163012993 TAGAAGAATGAATCTGGGCCAGG - Intergenic
917052254 1:170937816-170937838 AAAAATACTGATTATGGGCCGGG - Intronic
917644161 1:177013548-177013570 TAGAATACTGAATGTAGTTCTGG - Intronic
918579960 1:186114552-186114574 TAAAATACTAAATTTGGGCCTGG - Intronic
921836199 1:219781544-219781566 TGGAATGCTGAAAATGGACCAGG - Intronic
922581230 1:226699605-226699627 TTGAATGCTTAATATGCTCCAGG - Intronic
922814841 1:228441249-228441271 TAGAATCCTGACTTTGGGCCTGG + Intergenic
923425221 1:233862091-233862113 TAGCTTACTAAATATGCTCCTGG - Intergenic
1065851474 10:29793517-29793539 TAGAATACTGAAAGTGGGCTGGG + Intergenic
1066066931 10:31768714-31768736 TAGAATACATAATATAGTCTGGG - Intergenic
1067707294 10:48618233-48618255 TAGAATTCTGCATTAGGTCCTGG - Intronic
1068892168 10:62159402-62159424 TAGAATAGTGGAAATGGTACTGG + Intergenic
1069319444 10:67149768-67149790 TTGAATATTGACTATGGACCAGG - Intronic
1071738601 10:88330949-88330971 TATAATACTTAATATGGTTTAGG - Intronic
1072273490 10:93800290-93800312 TAGAATACTTAACATGGAACTGG + Intergenic
1073401156 10:103258714-103258736 TAAAATGCAGAATATGGGCCAGG - Intergenic
1073484996 10:103811375-103811397 TTGAGTACTGACTATGTTCCAGG + Intronic
1073833800 10:107417494-107417516 AAGAATATTGAATATTGTGCTGG - Intergenic
1073902280 10:108236546-108236568 CAAAATACTGAATACGGGCCAGG - Intergenic
1075219203 10:120569722-120569744 CAGAATCCTTAATAGGGTCCAGG + Intronic
1077625647 11:3769127-3769149 TTCAATAATGAATATGGGCCAGG + Intronic
1078077412 11:8174422-8174444 TAGAAGACTGAAGGTGGTCAGGG + Intergenic
1079324779 11:19482399-19482421 TAGAACATTCATTATGGTCCAGG - Intronic
1079352074 11:19700104-19700126 TTGAATACTTAATGTGTTCCAGG + Intronic
1080000345 11:27340983-27341005 TAGAATATTGAACATGATCATGG + Intronic
1080232441 11:30032972-30032994 TAGAGTACTTAACATGGGCCAGG - Intergenic
1081214218 11:40374495-40374517 TTGAATACTTAATATGTACCAGG + Intronic
1081223300 11:40489584-40489606 GAGGCTACTGAATATGTTCCAGG - Intronic
1081519869 11:43871495-43871517 AAGGATACAGAATATGGTGCAGG + Intergenic
1082781525 11:57291721-57291743 TAGTATCCTGAATAGGATCCTGG + Intergenic
1085653960 11:78295390-78295412 TTGAATAATGAATATGATCAGGG - Intronic
1086133951 11:83428232-83428254 AAAAATACTGAAATTGGTCCAGG - Intergenic
1086930911 11:92691953-92691975 TTGAGTACTGAATATGTGCCAGG - Intronic
1087408659 11:97762926-97762948 TAGAATACTGAGAGTGATCCAGG - Intergenic
1087433847 11:98088122-98088144 TAGAATATTGTATATGGACTAGG - Intergenic
1087501958 11:98967778-98967800 TAGAATACTGAAATTATTCCCGG - Intergenic
1088604642 11:111516384-111516406 TAGAACACTGTATATGGTTGGGG - Intronic
1088766191 11:112981544-112981566 TAGAATACTGAATATCTTATGGG + Intronic
1096656204 12:53093993-53094015 TTTAAAGCTGAATATGGTCCAGG + Intergenic
1096951380 12:55477990-55478012 TAGAGTACTTACTATGTTCCAGG + Intergenic
1097614813 12:61871404-61871426 AGAAATACTGAATGTGGTCCTGG + Intronic
1101301275 12:103485162-103485184 TAGAAAACTGAAACTGGGCCGGG - Intronic
1103114773 12:118317649-118317671 TAGAAAACTTAATATTGTCAAGG + Intronic
1103114926 12:118319518-118319540 TAGAAAACTTAATATTGTCAAGG + Intronic
1107019547 13:35737491-35737513 TAAAATACTTAGTATGGGCCAGG + Intergenic
1107456635 13:40561671-40561693 TAGAATATAGAATATAGGCCAGG + Intronic
1108436415 13:50405685-50405707 CAGAAAACTGAAAATGGTCCAGG + Intronic
1108546785 13:51503029-51503051 TAGAGAACTGAATATGTGCCAGG + Intergenic
1109580504 13:64326258-64326280 TAGAATACAGAATCTGAGCCAGG + Intergenic
1109725172 13:66331169-66331191 TAAATAACTGAATATGTTCCAGG - Intronic
1110437478 13:75491439-75491461 TTGAATACCTACTATGGTCCAGG + Intergenic
1111748862 13:92302121-92302143 TAGAATATTATATATTGTCCAGG - Intronic
1114967770 14:27984650-27984672 AAGAATACTGACTGTGGGCCGGG + Intergenic
1115038690 14:28893079-28893101 TGGAATACTTAATATGTGCCAGG + Intergenic
1115069265 14:29301566-29301588 TGGAATCCTGGATAAGGTCCAGG - Intergenic
1115380940 14:32738286-32738308 TAGAATAATGAATTTGGTTATGG - Intronic
1116651557 14:47600098-47600120 TATAATATTGCATATGGGCCAGG + Intronic
1116956690 14:50931169-50931191 TAGAATACTGAATATGGTCCTGG + Intronic
1118349397 14:64962867-64962889 TTGAATGCTGACTATGTTCCAGG - Intronic
1125618139 15:41034368-41034390 TAGACTGCTGAATATGGCTCAGG + Intronic
1128787835 15:70411168-70411190 TGGTATACAGAATATGGTTCTGG + Intergenic
1130686181 15:86039847-86039869 CAGAATTCTGAAGATGGGCCAGG - Intergenic
1135092654 16:19531670-19531692 TAAGATACTGAAGATGGGCCAGG + Intronic
1135746539 16:25021854-25021876 TGAAAAACTGAATATGGGCCAGG + Intergenic
1135975090 16:27103454-27103476 TAGAAAACGGGATATGGGCCAGG + Intergenic
1137648890 16:50101442-50101464 TAAAATTATGAATATGGACCAGG - Intronic
1138095224 16:54206108-54206130 TAGAATCTAGAATATGGTCCAGG + Intergenic
1140166868 16:72561760-72561782 TTGAATAATGACTATTGTCCAGG + Intergenic
1140197820 16:72870105-72870127 TAGATTAAAGAATATGGGCCAGG + Intronic
1141867978 16:86763770-86763792 GAGAATACTGAATGGGGTGCTGG - Intergenic
1146580135 17:34030259-34030281 TAGAAAACTGAAAGTGGTGCTGG - Intronic
1150019113 17:61592944-61592966 TAGAAAACTTAATATTGGCCGGG + Intergenic
1152383287 17:79953387-79953409 TAAAACACTGACTATGGGCCTGG + Intronic
1156845349 18:41659353-41659375 TTGAATACTGACTATTTTCCAGG - Intergenic
1161463735 19:4415462-4415484 TATAATACGGAATGTGGTCTTGG - Intronic
1162901633 19:13798578-13798600 TAGAATGCTAACTATGGGCCAGG + Intronic
1165339102 19:35197866-35197888 TGGAATACAGAATATGGTCTAGG + Intergenic
1166059771 19:40318974-40318996 TAAAATAGTTAAAATGGTCCAGG + Intergenic
1166631950 19:44414787-44414809 TAGAAAACAGATTATGGGCCTGG + Intergenic
925385690 2:3460110-3460132 TGGAATGCTGAATATGCTGCAGG - Intronic
929338882 2:40787943-40787965 TTGAATACTTACTATGTTCCAGG + Intergenic
930514330 2:52387041-52387063 AATAATTTTGAATATGGTCCTGG - Intergenic
935356190 2:102202135-102202157 CAGAGTTCTGGATATGGTCCTGG + Intronic
937756469 2:125545058-125545080 TAGAAAACTGAATTTAGGCCTGG + Intergenic
939456254 2:142440615-142440637 TAGAAGACTGAAAATTGTTCTGG - Intergenic
939697091 2:145340156-145340178 TTGAATACTGAATAGGTTCCAGG + Intergenic
939697174 2:145341095-145341117 TTGAATACTGAATAGGTTCCAGG + Intergenic
941556414 2:166988398-166988420 TGGAATTCTGAATTTGATCCTGG + Intronic
942812152 2:180012064-180012086 TAGGAAACTTAATATAGTCCTGG + Intergenic
944078792 2:195760911-195760933 TAGGATACTGAATAGTGTCTGGG + Intronic
944415972 2:199480140-199480162 AATAATAATTAATATGGTCCAGG + Intergenic
947954168 2:234173415-234173437 TAGAATAAAAACTATGGTCCAGG + Intergenic
948303382 2:236926714-236926736 TTGAATGCTTAATATGTTCCTGG + Intergenic
1169708144 20:8531101-8531123 TAGAAAAATGAATAGGGTCATGG + Intronic
1170084999 20:12520379-12520401 TAGAATACAGAATATTGGCTGGG - Intergenic
1177413671 21:20766747-20766769 TAGAATGGTGAATATTTTCCAGG + Intergenic
1177708505 21:24740059-24740081 TAGGATAGTGAATAAGGCCCAGG - Intergenic
1177930344 21:27274174-27274196 TAAAATACTGAATATATTCTAGG + Intergenic
1182783375 22:32885854-32885876 TAGAAAAGGGAATATGGGCCTGG - Intronic
949321228 3:2812712-2812734 TAGACTACTGACTTTGGACCAGG + Intronic
949783644 3:7717072-7717094 TAGAATACTGCACATCTTCCTGG + Intronic
949986698 3:9546823-9546845 TAAAATGCTGAGTGTGGTCCTGG - Intronic
951704935 3:25534928-25534950 AAGCATACAGAATATGGTCTGGG - Intronic
953668545 3:44943609-44943631 TAGAGGACTGAATCTGCTCCAGG - Intronic
956036106 3:65094037-65094059 CAGAATATTGAATTTGGGCCTGG + Intergenic
957473792 3:80697451-80697473 AAGAAGACAGAATATGGTGCAGG - Intergenic
957708456 3:83821507-83821529 AAGAATACTGAATATAGACAAGG - Intergenic
959488193 3:106952934-106952956 TAGAACACTCAATATAGTACAGG - Intergenic
963165924 3:142203477-142203499 TAAAATAATTAATATGGGCCAGG + Intronic
963796657 3:149637524-149637546 GTTAATACTGAATATGGGCCGGG - Intronic
964542091 3:157790727-157790749 AGTTATACTGAATATGGTCCTGG + Intergenic
964691128 3:159451100-159451122 AAGAATACTAAATGTGGGCCGGG - Intronic
965517678 3:169639045-169639067 TAAGATACTGAATAAGCTCCTGG + Intronic
971341244 4:25771048-25771070 TAGAAGGCTAAATATGGTCAGGG - Intronic
971472144 4:27039172-27039194 AATAATACAGAATATGGACCAGG - Intergenic
972832045 4:42825573-42825595 TAGAGCACTGATTATGTTCCAGG + Intergenic
973666753 4:53167464-53167486 GAGAATACTGAATATTGAGCAGG + Intronic
974195786 4:58572937-58572959 TAGAAGATTAAATATTGTCCAGG - Intergenic
974828275 4:67156741-67156763 GATAATACTGAATATGATTCTGG + Intergenic
975218380 4:71784003-71784025 TAGAAAAATGAAGAGGGTCCTGG - Exonic
975585559 4:75944759-75944781 TAGAAAACTGAAAATGGGCTGGG - Intronic
975923633 4:79422853-79422875 TTGAATACTAACTATGGTCCAGG + Intergenic
976201916 4:82587376-82587398 TTGAATATTGAATATGTGCCAGG - Intergenic
978100680 4:104837170-104837192 TAGGATTCTGAATAAGATCCTGG - Intergenic
978274477 4:106933107-106933129 TAGAAGACTGGATGGGGTCCAGG + Intronic
979061177 4:116062939-116062961 TTGAAAACTGCATATGGTCCTGG - Intergenic
980091334 4:128446056-128446078 TTGAATACTTATTATGTTCCAGG - Intergenic
982699116 4:158639573-158639595 TAGAAAACAGACTCTGGTCCAGG + Intronic
983279486 4:165662226-165662248 TTGAATTCTGAATATGGCACAGG + Intergenic
984344231 4:178501425-178501447 TATAATACTCAATATTGTTCAGG + Intergenic
989062174 5:37420032-37420054 TAGAAAACAAAATATGGGCCAGG - Intronic
989301368 5:39898087-39898109 TGGAATACTGACTATATTCCAGG - Intergenic
993525400 5:88959705-88959727 TAGAACACTGTAAAAGGTCCAGG - Intergenic
994813909 5:104558725-104558747 TGGATTCCTGAATAGGGTCCTGG - Intergenic
997307922 5:132853486-132853508 TTGAACACTGACTATGGGCCAGG - Intergenic
1002612633 5:180431470-180431492 TAGAATACAAAATATTGGCCGGG - Intergenic
1005610273 6:27517341-27517363 TGGAATTCTGAATAGGATCCTGG - Intergenic
1006690236 6:35877545-35877567 TAGAAGACTGAAAATGGGCCGGG + Intronic
1006786371 6:36670118-36670140 TAAAAAACTGAAAATGGGCCGGG + Intergenic
1007586160 6:42991005-42991027 TAGAATACCGCATAAGGGCCGGG - Intronic
1008929811 6:56926901-56926923 TAGAATTATGAATATGCTCTTGG - Intronic
1010159593 6:72837234-72837256 TTGAACACTTAATATGCTCCAGG + Intronic
1012802223 6:103845240-103845262 TAGAATCCTGGATCTGGTTCTGG - Intergenic
1018082978 6:160274741-160274763 TAGAATAAAGAATCTGGACCAGG - Intronic
1018159736 6:161027195-161027217 TAGAATACAGAATGTGATACAGG + Intronic
1021062395 7:16130237-16130259 TACAATACTGGATATTTTCCAGG + Intronic
1023709596 7:42977594-42977616 TAGTATACTGAGTATGGTGATGG - Intergenic
1024768314 7:52687318-52687340 TAGAAAACGTAATATGATCCAGG - Intergenic
1025983415 7:66426680-66426702 TAAAAGCCTGAATATGGACCTGG - Intergenic
1026031784 7:66800634-66800656 TAAAAGCCTGAATATGGACCTGG + Intronic
1027125738 7:75555545-75555567 TAGATTCCTAAAAATGGTCCAGG + Exonic
1027374993 7:77539195-77539217 TATAATACTGTGTATGGTCAAGG - Intronic
1027796978 7:82707931-82707953 TTGAATACTTAATATGTGCCAGG + Intergenic
1028510019 7:91614239-91614261 CAGAAGTCTGAATATGGTGCAGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1031740923 7:125429705-125429727 AAGAATAATGAAAATGGTCCAGG - Intergenic
1033985620 7:147222345-147222367 CAGTATACTGAATATGGTCCAGG - Intronic
1038076990 8:24087278-24087300 AAGATTGCTGAATATTGTCCAGG - Intergenic
1038797213 8:30720566-30720588 TTGAATAGTGAATATGTGCCAGG - Intronic
1048298770 8:133236091-133236113 GTGAATTCTCAATATGGTCCAGG + Intergenic
1048652328 8:136491877-136491899 TTAAACACTGAATATGTTCCAGG - Intergenic
1049838823 8:144757164-144757186 TAGAGTACTTACTATGTTCCAGG - Intergenic
1050102265 9:2131341-2131363 TGGTATACTGAATAAGCTCCTGG + Intronic
1055685834 9:78773732-78773754 TAAAATCCAAAATATGGTCCAGG - Intergenic
1056689546 9:88795162-88795184 GAGTAGACTGAATATGGTCATGG + Intergenic
1057906157 9:98985085-98985107 TATAAAACTGAATAGGGGCCAGG - Intronic
1058050345 9:100400054-100400076 TTGAAAACTGAATAAAGTCCAGG - Intergenic
1058947579 9:109873165-109873187 TAGAAAACTGAATTTAGGCCAGG + Intronic
1062208388 9:135349646-135349668 TAAAAGAATGAATATGGGCCAGG + Intergenic
1186608905 X:11119502-11119524 TAGAACACTGCATATGCTGCTGG + Intronic
1188228155 X:27627598-27627620 AAGAATACATAATATGGGCCGGG + Intronic
1191707148 X:64105220-64105242 CAGATTACAGAATATGGTCCTGG - Intergenic
1191885655 X:65885386-65885408 TTGAATACTTATTATGTTCCAGG - Intergenic
1193458521 X:81760791-81760813 TAAAATAGTGAAGATGGGCCTGG + Intergenic
1193992716 X:88328091-88328113 TAGAAAAGTGAATATTGGCCTGG - Intergenic
1196233805 X:113255717-113255739 TAGAGCACTGAATAGGCTCCTGG - Intergenic
1196318405 X:114257512-114257534 TTGAATACTGACAATGTTCCAGG - Intergenic
1196576702 X:117326433-117326455 TTAAATACTTACTATGGTCCAGG + Intergenic
1196630053 X:117927566-117927588 AAGAATTCGGAAGATGGTCCAGG + Intronic
1199103106 X:143829135-143829157 TAGAATAATGAATCTTTTCCAGG - Intergenic