ID: 1116968340

View in Genome Browser
Species Human (GRCh38)
Location 14:51038496-51038518
Sequence TGCTCAGAATATGCATCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116968337_1116968340 21 Left 1116968337 14:51038452-51038474 CCTTTGGCGGTGGTCGGATTGCT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1116968340 14:51038496-51038518 TGCTCAGAATATGCATCTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 149
1116968336_1116968340 24 Left 1116968336 14:51038449-51038471 CCACCTTTGGCGGTGGTCGGATT 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1116968340 14:51038496-51038518 TGCTCAGAATATGCATCTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 149
1116968338_1116968340 -5 Left 1116968338 14:51038478-51038500 CCTGATATTTTGTAAACCTGCTC 0: 1
1: 0
2: 1
3: 15
4: 134
Right 1116968340 14:51038496-51038518 TGCTCAGAATATGCATCTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116968340 Original CRISPR TGCTCAGAATATGCATCTCC TGG Intronic
900378531 1:2372466-2372488 TGCCAAGAGTAAGCATCTCCAGG - Exonic
903445753 1:23422058-23422080 AGCTGTGAATATGCAGCTCCGGG + Intronic
905189957 1:36225795-36225817 GGCTCACAAAATACATCTCCCGG - Intronic
905385456 1:37600381-37600403 GGCTCAGAATATACATCTTCAGG + Intergenic
908954808 1:69610741-69610763 TGGTAAGTATATTCATCTCCAGG + Intronic
915791804 1:158680437-158680459 TGTTCAGAATATGTTACTCCAGG + Intronic
916810982 1:168305462-168305484 TGCTCAGAATATCAGTGTCCTGG - Intronic
917089580 1:171339378-171339400 TATTCTGAATAAGCATCTCCAGG + Intronic
920654961 1:207868302-207868324 TGCTCAGAGTCTGCGGCTCCCGG + Intergenic
920778923 1:208969173-208969195 GGCTCAGAAGCAGCATCTCCAGG + Intergenic
922817718 1:228462711-228462733 AGCTAAGAACATGCATCTCATGG + Intergenic
1062935709 10:1385178-1385200 TGTTCAGAATATGGATTTCACGG - Intronic
1066817526 10:39438830-39438852 TGCTCCAAATATGCAACTGCAGG + Intergenic
1068348312 10:55812994-55813016 TTCTCAGAAGATCCATCTTCAGG + Intergenic
1068625818 10:59245331-59245353 TGCTTACAAAATTCATCTCCTGG - Exonic
1069098439 10:64288473-64288495 TGCTGAGACTTTGCTTCTCCAGG - Intergenic
1069739154 10:70676525-70676547 TGCGCAGAATCTGCCTCTCAGGG + Intronic
1073044529 10:100628921-100628943 TGCCCAGAGTCTGCAACTCCAGG - Intergenic
1073293980 10:102427492-102427514 TTCTCAGTAAATGCATGTCCAGG + Intronic
1073787579 10:106907085-106907107 TGCACTAAATATGCATCTACTGG - Intronic
1074333885 10:112548743-112548765 TTCTCAGACTATCCATCTCTGGG - Intronic
1075635324 10:124026769-124026791 TGCTGAGTTTTTGCATCTCCAGG - Intronic
1075872521 10:125781247-125781269 TACTAAGAATATGCAAATCCAGG - Intergenic
1077647248 11:3936489-3936511 TGCTCAGCCTTTGCTTCTCCAGG + Intronic
1078723829 11:13909678-13909700 TGCTCAGAGAATGAATCTCATGG + Intergenic
1082315419 11:50712401-50712423 CGCTCTGAATATCCATTTCCAGG + Intergenic
1083073842 11:60016627-60016649 TATTCTGAATATGAATCTCCTGG - Intergenic
1091227912 11:133968798-133968820 TGCACAGACTATTCATCTCCTGG - Intergenic
1091767380 12:3130449-3130471 TGCTCTGGAAAGGCATCTCCAGG + Intronic
1091841241 12:3622582-3622604 AGCTCAGAATGTGCAGCTGCTGG + Intronic
1095384043 12:41629203-41629225 TACTGAGAATATGCCTGTCCAGG + Intergenic
1098573106 12:72011504-72011526 TGCTCAGAATTAGCAGCTACAGG - Intronic
1102891119 12:116559320-116559342 TGCACAGAAGATGGCTCTCCGGG + Intergenic
1103044188 12:117721773-117721795 TGCTGAAATTATGCATCTCATGG + Intronic
1107105151 13:36635269-36635291 AGATCAGAATATGTAACTCCAGG + Intergenic
1108523634 13:51266449-51266471 TGCTCTGAGGATGCATCTGCAGG + Intronic
1111398292 13:87697367-87697389 TGAGCTGAATATCCATCTCCAGG + Intergenic
1115374301 14:32656452-32656474 TACTCTGAATAAGCATCACCTGG + Intronic
1116968340 14:51038496-51038518 TGCTCAGAATATGCATCTCCTGG + Intronic
1121008780 14:90507682-90507704 TGCTCAGGCTATCCCTCTCCTGG + Intergenic
1121609375 14:95265671-95265693 TGCTCGGAATATGACTCACCAGG - Intronic
1121994311 14:98590130-98590152 TGCTGTGAATATTCATGTCCAGG - Intergenic
1126836101 15:52666968-52666990 CGCTCAGAATATAAGTCTCCTGG - Intronic
1126970231 15:54102767-54102789 TGCTCAGAAGATGCACCCCAGGG + Intronic
1127520744 15:59740939-59740961 TTCTCAGAAAATCCATGTCCTGG - Intergenic
1131349757 15:91688434-91688456 TGTTCAGAATAGGCATCTTCAGG + Intergenic
1131757294 15:95578992-95579014 TCTTCAGAATGTGCCTCTCCTGG - Intergenic
1132682736 16:1150023-1150045 TGCTCTGAACATCCATCTGCCGG - Intergenic
1133592870 16:7263214-7263236 TGCTCAGGATATTCAGCACCAGG + Intronic
1133665956 16:7968067-7968089 TGCTCATGATAGGCATTTCCTGG - Intergenic
1133842866 16:9425807-9425829 TGTTCAGATTATGCATCTCTGGG - Intergenic
1135756896 16:25106207-25106229 TGCTCAGATTTTTCATCTCTGGG + Intergenic
1135964111 16:27021755-27021777 CACTTAGAATATGCTTCTCCTGG + Intergenic
1136924284 16:34357371-34357393 TGTATAGAATATGCATCTTCTGG + Intergenic
1136980289 16:35054435-35054457 TGTATAGAATATGCATCTTCTGG - Intergenic
1139968285 16:70757707-70757729 TGATCTCAATGTGCATCTCCAGG + Intronic
1140554734 16:75908928-75908950 TGCTGAGACCATGCTTCTCCTGG + Intergenic
1144451575 17:15384325-15384347 TGCTCAAAATATGCAGCTTGTGG - Intergenic
1144621260 17:16819976-16819998 GGCTCTCAATCTGCATCTCCAGG + Intergenic
1145287747 17:21519113-21519135 TGCTGAGAACATTCAGCTCCAGG + Intergenic
1147486553 17:40820552-40820574 GGCTCTCAATTTGCATCTCCAGG + Exonic
1147573240 17:41584298-41584320 GGCTCTCAATCTGCATCTCCAGG + Exonic
1150189390 17:63221939-63221961 TGCTCTGAATATTCAACTACTGG - Intronic
1152473066 17:80500880-80500902 ACCCCAGAACATGCATCTCCTGG - Intergenic
1153801429 18:8674106-8674128 TGATGAGAATATGCATGTCTTGG + Intergenic
1156347280 18:36269223-36269245 TGCTCAGAATATAAATATTCTGG - Exonic
1156853405 18:41754752-41754774 TGCTCAGAATTTGCTTAGCCAGG - Intergenic
1157593798 18:48851664-48851686 TGCTCAGTCAATGCTTCTCCCGG - Intronic
1159599166 18:70412220-70412242 TGGTCAGAACAGGCATCACCGGG + Intergenic
1159857265 18:73604026-73604048 TGCTCAGAAGCTTCAGCTCCTGG + Intergenic
1160168805 18:76535931-76535953 TGGTCAGAAGATGCCTCACCGGG + Intergenic
1160415577 18:78707600-78707622 TGCTAGGAACATGCATGTCCAGG + Intergenic
1160666934 19:335334-335356 TGCACAGAACATGCAGCTGCAGG + Intronic
1163274099 19:16272089-16272111 TGCTATGAATATTCATGTCCAGG + Intergenic
926396226 2:12445566-12445588 TGGTCACAAGATGCATCTTCCGG + Intergenic
927303523 2:21543288-21543310 TGCTCAATATATGCATATTCAGG - Intergenic
927379625 2:22464051-22464073 TGAACAGAATATTCATCTTCAGG - Intergenic
927805414 2:26142567-26142589 TGCTAAGAATATCCCTATCCTGG - Intergenic
928310842 2:30208445-30208467 TCCTTAGAATATGTATCTTCAGG + Intergenic
928894923 2:36250054-36250076 TGTTCAGAATATTGATCTCCTGG - Intergenic
929723609 2:44399088-44399110 TGCTCACAATCTGCTTGTCCTGG + Intronic
931838142 2:66121318-66121340 TGCCCAGAATATGCATAACTGGG + Intergenic
932187449 2:69711002-69711024 TGCTCTGAATATTCATATACAGG - Intronic
938636873 2:133237563-133237585 TGTTCAGTATCTGCTTCTCCTGG - Intronic
938775845 2:134540516-134540538 TGCTAGGAAGATGCATTTCCAGG + Intronic
940902739 2:159140989-159141011 TGCTCAGAATCTCCATCTGCTGG - Intronic
945598939 2:211833957-211833979 TGCTCTGAATATGCACCTAGGGG - Intronic
945987122 2:216363934-216363956 TGCTCAGATTAAAAATCTCCTGG + Intronic
947344654 2:229178314-229178336 TGCTCAGGACAGGCATCTCCTGG + Intronic
1170367699 20:15615836-15615858 AGCTCATAATGTGCATCTCAGGG - Intronic
1170541167 20:17389555-17389577 TGCTCAGACTTTGCAGCTTCAGG + Intronic
1170800715 20:19587888-19587910 TGCTCAGAATACGCATCCCTGGG + Intronic
1172540392 20:35710295-35710317 TGCTCAAAATTGGCATCTCAGGG + Intronic
1175567859 20:59994981-59995003 TGCTCAGCATGTTCATCTTCTGG - Intronic
1177406669 21:20677024-20677046 TGCTCGACATATGCATCTCTAGG + Intergenic
1180148332 21:45934305-45934327 TGCTCAGCATTTCCATTTCCTGG - Intronic
1184032119 22:41901218-41901240 GGCTGAGAATCTGAATCTCCAGG - Intronic
949224318 3:1675210-1675232 TGGTGAGAATATGCAGTTCCTGG - Intergenic
950530724 3:13550993-13551015 AGTTCAGGATCTGCATCTCCTGG + Intronic
951799463 3:26579187-26579209 TGCTCATAATGAGCATGTCCTGG + Intergenic
952252921 3:31671965-31671987 AGCCAAGAATATGCATCTCTAGG - Intronic
955386483 3:58485139-58485161 TGCTCAGAATATGCCACAACGGG + Intergenic
956784882 3:72634164-72634186 TCATCAGAATATGCACCTCATGG - Intergenic
959130129 3:102344708-102344730 TGCCCAAAAAAGGCATCTCCGGG + Intronic
959382073 3:105653371-105653393 TAGGCAGAATTTGCATCTCCAGG + Intergenic
960843425 3:121983964-121983986 TGCTCAGATTTTCCATATCCTGG + Intergenic
964866815 3:161271235-161271257 GGCTCAGAAGATTCATTTCCAGG - Intergenic
965914093 3:173819853-173819875 TTCTCAGGATATGCATTTCTAGG + Intronic
966295189 3:178411978-178412000 TTATCAGAATATGGAACTCCAGG - Intergenic
968020715 3:195386173-195386195 TGTTCAGAATAGGCAAATCCAGG + Intronic
968296863 3:197583184-197583206 TGCCCAAGATACGCATCTCCTGG - Intergenic
981546278 4:145897447-145897469 TGCACAGATTATGCAGATCCAGG - Intronic
981933795 4:150217946-150217968 TGCTAAGAAGCTGCATTTCCTGG + Intronic
984296990 4:177865097-177865119 TTTTCATAATATGCATTTCCTGG - Intronic
986873325 5:12077150-12077172 TGATCAGACTATGCATTTTCAGG - Intergenic
988896319 5:35678414-35678436 TGCTCAGACTCTGCATTTCCTGG + Intronic
988969651 5:36454295-36454317 TCCTCTGATTCTGCATCTCCTGG - Intergenic
989264989 5:39463296-39463318 TGCTCAGCATCAGCATCACCTGG + Intergenic
992122080 5:73605235-73605257 AGATAAGAATATGGATCTCCTGG + Intergenic
992423731 5:76633988-76634010 TGCTATGAATATTCATGTCCAGG + Intronic
1003913502 6:10764268-10764290 TGCTAAGAAAATGCATTTCTTGG + Exonic
1004617505 6:17304349-17304371 TTCTCAGCATATTCATCACCTGG - Intergenic
1004835229 6:19523398-19523420 TGCTCAGTACAGGCATCTGCTGG - Intergenic
1006311522 6:33264427-33264449 CGCTCTGAACATTCATCTCCAGG + Exonic
1007369606 6:41417794-41417816 TGCTCACAATCTGCCACTCCAGG + Intergenic
1007590273 6:43016865-43016887 AGCTCAGAATCTGCATATCATGG - Intronic
1007923391 6:45630715-45630737 TGCCAAGAATTTGCATCTCCAGG + Intronic
1011040121 6:83020983-83021005 TGCTCAAAATTTGCTTCTGCAGG + Intronic
1012221435 6:96653631-96653653 GGTTCCAAATATGCATCTCCTGG - Intergenic
1013260692 6:108438624-108438646 TCCTCATAATATCCATCTACAGG - Intronic
1013640295 6:112069585-112069607 AGCTCAGAAAATATATCTCCAGG - Exonic
1013772752 6:113645805-113645827 TGCTGAAAATATGCACCTCCTGG + Intergenic
1022130995 7:27404459-27404481 TGCTCAGAAATTGCATCTCAGGG + Intergenic
1024363458 7:48493896-48493918 TGGTCAGAATATGAATCAGCTGG - Intronic
1033634868 7:143202748-143202770 TGCTCAGAATATGCATGTCATGG - Intergenic
1038551316 8:28471833-28471855 TGATCAAAATATCCATCTCTGGG - Intronic
1039218286 8:35298099-35298121 TGCTCTGAATATGCAAGTCCTGG + Intronic
1040604256 8:48914122-48914144 TGATCAGATTATGTATCACCTGG + Intergenic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1043987143 8:86707401-86707423 TGGTCAGAAAAGGCCTCTCCAGG + Intronic
1044870887 8:96618806-96618828 TTCTCAGAATCAGAATCTCCAGG - Intergenic
1045635272 8:104178909-104178931 TGCTCAGGATGTGCCTCTCTAGG + Intronic
1046887614 8:119385238-119385260 TGCTTAGAAAATGCTGCTCCAGG + Intergenic
1047091128 8:121577021-121577043 TACTCAGAAAATACATATCCAGG + Intergenic
1048398721 8:134042308-134042330 TGCACACAATATGCCTGTCCAGG - Intergenic
1048906754 8:139096262-139096284 TGGACAGAGCATGCATCTCCTGG - Intergenic
1050576576 9:7002552-7002574 TGCTCAGAATATGTTCCTTCTGG + Intronic
1054711724 9:68517219-68517241 TGCTGAGAGTTTGCATCTCAGGG + Intronic
1056115681 9:83439058-83439080 GACTCAGAATAGGCATGTCCAGG - Intronic
1058055446 9:100444137-100444159 TGATCATAATTTGCTTCTCCAGG - Intronic
1060047600 9:120353186-120353208 TGCTCAGAATAGGCAAATCGAGG + Intergenic
1060672305 9:125480670-125480692 TGCTTAGAATATGCTTCTATGGG + Intronic
1060799413 9:126534216-126534238 TTCACAAAATATGCATCCCCAGG - Intergenic
1185598748 X:1324828-1324850 TCCTCAGAGTCTGCACCTCCGGG - Intergenic
1186504243 X:10077652-10077674 TGCTCAGAAGACACATCTGCAGG - Intronic
1188645920 X:32567169-32567191 TACTCAGAATCTGCTTCACCTGG + Intronic
1189049276 X:37627483-37627505 TGCTCTGAATCAGCATCCCCTGG + Intronic
1189792314 X:44615801-44615823 TGCTCAGAATATGCAAGTATTGG - Intergenic
1191053288 X:56217058-56217080 TGCTCAGAATCTGGTTCTCCTGG + Intergenic
1192432338 X:71120906-71120928 TGCTTAGAATATCCTTCTACTGG - Intronic
1195110086 X:101639677-101639699 TGCCCAAAATCTGCATCTCCAGG - Intergenic
1198637547 X:138715925-138715947 TGCTCTCAAGAGGCATCTCCAGG + Intronic
1198735746 X:139783358-139783380 TGCTCAGAATATACAACACTTGG - Intronic
1199287649 X:146071725-146071747 TGCTCAGAAGTTGCACCTACTGG + Intergenic
1199431996 X:147772385-147772407 TGCTCAAGATTTTCATCTCCTGG - Intergenic
1200330355 X:155289891-155289913 TACTCAGAATAAGCAACTTCTGG + Intronic