ID: 1116974200

View in Genome Browser
Species Human (GRCh38)
Location 14:51097315-51097337
Sequence GTTCACCCTGTTCCAAACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116974197_1116974200 13 Left 1116974197 14:51097279-51097301 CCTAGGAGAGCTCTTAAAATGAC No data
Right 1116974200 14:51097315-51097337 GTTCACCCTGTTCCAAACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116974200 Original CRISPR GTTCACCCTGTTCCAAACAG GGG Intergenic
No off target data available for this crispr