ID: 1116976012

View in Genome Browser
Species Human (GRCh38)
Location 14:51116804-51116826
Sequence CTGAGTGTCCAAAAGTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116976012_1116976015 29 Left 1116976012 14:51116804-51116826 CCAATTTACTTTTGGACACTCAG No data
Right 1116976015 14:51116856-51116878 TGTTAAGTGCCTTCTGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116976012 Original CRISPR CTGAGTGTCCAAAAGTAAAT TGG (reversed) Intergenic
No off target data available for this crispr