ID: 1116976015

View in Genome Browser
Species Human (GRCh38)
Location 14:51116856-51116878
Sequence TGTTAAGTGCCTTCTGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116976012_1116976015 29 Left 1116976012 14:51116804-51116826 CCAATTTACTTTTGGACACTCAG No data
Right 1116976015 14:51116856-51116878 TGTTAAGTGCCTTCTGAGTCAGG No data
1116976013_1116976015 -9 Left 1116976013 14:51116842-51116864 CCTGTTTGACAGCCTGTTAAGTG No data
Right 1116976015 14:51116856-51116878 TGTTAAGTGCCTTCTGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116976015 Original CRISPR TGTTAAGTGCCTTCTGAGTC AGG Intergenic
No off target data available for this crispr