ID: 1116978126

View in Genome Browser
Species Human (GRCh38)
Location 14:51138545-51138567
Sequence GGCCTGAGTAGAACAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116978126_1116978129 -10 Left 1116978126 14:51138545-51138567 CCACCTTTTGTTCTACTCAGGCC No data
Right 1116978129 14:51138558-51138580 TACTCAGGCCCTCAATGGATTGG No data
1116978126_1116978134 16 Left 1116978126 14:51138545-51138567 CCACCTTTTGTTCTACTCAGGCC No data
Right 1116978134 14:51138584-51138606 ATGCCCACTCACATTAAGGAAGG No data
1116978126_1116978133 12 Left 1116978126 14:51138545-51138567 CCACCTTTTGTTCTACTCAGGCC No data
Right 1116978133 14:51138580-51138602 GGTGATGCCCACTCACATTAAGG No data
1116978126_1116978130 -9 Left 1116978126 14:51138545-51138567 CCACCTTTTGTTCTACTCAGGCC No data
Right 1116978130 14:51138559-51138581 ACTCAGGCCCTCAATGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116978126 Original CRISPR GGCCTGAGTAGAACAAAAGG TGG (reversed) Intergenic
No off target data available for this crispr