ID: 1116983555

View in Genome Browser
Species Human (GRCh38)
Location 14:51195924-51195946
Sequence GTAGACTAGCAGGTACACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116983550_1116983555 7 Left 1116983550 14:51195894-51195916 CCACCTGGTCATTCAAGGCTCCA No data
Right 1116983555 14:51195924-51195946 GTAGACTAGCAGGTACACAAAGG No data
1116983551_1116983555 4 Left 1116983551 14:51195897-51195919 CCTGGTCATTCAAGGCTCCATGT No data
Right 1116983555 14:51195924-51195946 GTAGACTAGCAGGTACACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116983555 Original CRISPR GTAGACTAGCAGGTACACAA AGG Intergenic
No off target data available for this crispr