ID: 1116991366

View in Genome Browser
Species Human (GRCh38)
Location 14:51280380-51280402
Sequence CACATCTAGCTCTATGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116991366_1116991367 2 Left 1116991366 14:51280380-51280402 CCAAGATCATAGAGCTAGATGTG No data
Right 1116991367 14:51280405-51280427 TACTGCTTCTCAGAAGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116991366 Original CRISPR CACATCTAGCTCTATGATCT TGG (reversed) Intergenic
No off target data available for this crispr