ID: 1116992128

View in Genome Browser
Species Human (GRCh38)
Location 14:51287635-51287657
Sequence TCGAGATCTTGGCTTCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116992128_1116992137 8 Left 1116992128 14:51287635-51287657 CCCTTGAGAAGCCAAGATCTCGA No data
Right 1116992137 14:51287666-51287688 TATGTGGGGGTGTCAAAAGCAGG No data
1116992128_1116992136 -5 Left 1116992128 14:51287635-51287657 CCCTTGAGAAGCCAAGATCTCGA No data
Right 1116992136 14:51287653-51287675 CTCGAGGCAGGCATATGTGGGGG No data
1116992128_1116992139 16 Left 1116992128 14:51287635-51287657 CCCTTGAGAAGCCAAGATCTCGA No data
Right 1116992139 14:51287674-51287696 GGTGTCAAAAGCAGGTCAGGAGG No data
1116992128_1116992138 13 Left 1116992128 14:51287635-51287657 CCCTTGAGAAGCCAAGATCTCGA No data
Right 1116992138 14:51287671-51287693 GGGGGTGTCAAAAGCAGGTCAGG No data
1116992128_1116992135 -6 Left 1116992128 14:51287635-51287657 CCCTTGAGAAGCCAAGATCTCGA No data
Right 1116992135 14:51287652-51287674 TCTCGAGGCAGGCATATGTGGGG No data
1116992128_1116992133 -8 Left 1116992128 14:51287635-51287657 CCCTTGAGAAGCCAAGATCTCGA No data
Right 1116992133 14:51287650-51287672 GATCTCGAGGCAGGCATATGTGG No data
1116992128_1116992134 -7 Left 1116992128 14:51287635-51287657 CCCTTGAGAAGCCAAGATCTCGA No data
Right 1116992134 14:51287651-51287673 ATCTCGAGGCAGGCATATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116992128 Original CRISPR TCGAGATCTTGGCTTCTCAA GGG (reversed) Intergenic