ID: 1116992132

View in Genome Browser
Species Human (GRCh38)
Location 14:51287646-51287668
Sequence ATATGCCTGCCTCGAGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116992132_1116992138 2 Left 1116992132 14:51287646-51287668 CCAAGATCTCGAGGCAGGCATAT No data
Right 1116992138 14:51287671-51287693 GGGGGTGTCAAAAGCAGGTCAGG No data
1116992132_1116992137 -3 Left 1116992132 14:51287646-51287668 CCAAGATCTCGAGGCAGGCATAT No data
Right 1116992137 14:51287666-51287688 TATGTGGGGGTGTCAAAAGCAGG No data
1116992132_1116992139 5 Left 1116992132 14:51287646-51287668 CCAAGATCTCGAGGCAGGCATAT No data
Right 1116992139 14:51287674-51287696 GGTGTCAAAAGCAGGTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116992132 Original CRISPR ATATGCCTGCCTCGAGATCT TGG (reversed) Intergenic