ID: 1116992133

View in Genome Browser
Species Human (GRCh38)
Location 14:51287650-51287672
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116992128_1116992133 -8 Left 1116992128 14:51287635-51287657 CCCTTGAGAAGCCAAGATCTCGA No data
Right 1116992133 14:51287650-51287672 GATCTCGAGGCAGGCATATGTGG No data
1116992129_1116992133 -9 Left 1116992129 14:51287636-51287658 CCTTGAGAAGCCAAGATCTCGAG No data
Right 1116992133 14:51287650-51287672 GATCTCGAGGCAGGCATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116992133 Original CRISPR GATCTCGAGGCAGGCATATG TGG Intergenic
No off target data available for this crispr