ID: 1116992139

View in Genome Browser
Species Human (GRCh38)
Location 14:51287674-51287696
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116992132_1116992139 5 Left 1116992132 14:51287646-51287668 CCAAGATCTCGAGGCAGGCATAT No data
Right 1116992139 14:51287674-51287696 GGTGTCAAAAGCAGGTCAGGAGG No data
1116992129_1116992139 15 Left 1116992129 14:51287636-51287658 CCTTGAGAAGCCAAGATCTCGAG No data
Right 1116992139 14:51287674-51287696 GGTGTCAAAAGCAGGTCAGGAGG No data
1116992128_1116992139 16 Left 1116992128 14:51287635-51287657 CCCTTGAGAAGCCAAGATCTCGA No data
Right 1116992139 14:51287674-51287696 GGTGTCAAAAGCAGGTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116992139 Original CRISPR GGTGTCAAAAGCAGGTCAGG AGG Intergenic
No off target data available for this crispr