ID: 1116993008

View in Genome Browser
Species Human (GRCh38)
Location 14:51294994-51295016
Sequence TTCTCCGCTAATAACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116993008_1116993013 16 Left 1116993008 14:51294994-51295016 CCTTCCATGTTATTAGCGGAGAA No data
Right 1116993013 14:51295033-51295055 GGAGGAAAAAGAGATGTAGCAGG No data
1116993008_1116993010 -6 Left 1116993008 14:51294994-51295016 CCTTCCATGTTATTAGCGGAGAA No data
Right 1116993010 14:51295011-51295033 GGAGAAAAAGAGACAGATTGAGG No data
1116993008_1116993012 -2 Left 1116993008 14:51294994-51295016 CCTTCCATGTTATTAGCGGAGAA No data
Right 1116993012 14:51295015-51295037 AAAAAGAGACAGATTGAGGGAGG No data
1116993008_1116993011 -5 Left 1116993008 14:51294994-51295016 CCTTCCATGTTATTAGCGGAGAA No data
Right 1116993011 14:51295012-51295034 GAGAAAAAGAGACAGATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116993008 Original CRISPR TTCTCCGCTAATAACATGGA AGG (reversed) Intergenic
No off target data available for this crispr