ID: 1116993012

View in Genome Browser
Species Human (GRCh38)
Location 14:51295015-51295037
Sequence AAAAAGAGACAGATTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116993007_1116993012 -1 Left 1116993007 14:51294993-51295015 CCCTTCCATGTTATTAGCGGAGA No data
Right 1116993012 14:51295015-51295037 AAAAAGAGACAGATTGAGGGAGG No data
1116993008_1116993012 -2 Left 1116993008 14:51294994-51295016 CCTTCCATGTTATTAGCGGAGAA No data
Right 1116993012 14:51295015-51295037 AAAAAGAGACAGATTGAGGGAGG No data
1116993006_1116993012 0 Left 1116993006 14:51294992-51295014 CCCCTTCCATGTTATTAGCGGAG No data
Right 1116993012 14:51295015-51295037 AAAAAGAGACAGATTGAGGGAGG No data
1116993009_1116993012 -6 Left 1116993009 14:51294998-51295020 CCATGTTATTAGCGGAGAAAAAG No data
Right 1116993012 14:51295015-51295037 AAAAAGAGACAGATTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116993012 Original CRISPR AAAAAGAGACAGATTGAGGG AGG Intergenic
No off target data available for this crispr