ID: 1116994630

View in Genome Browser
Species Human (GRCh38)
Location 14:51309869-51309891
Sequence CTTTCTTAAGAAACCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116994627_1116994630 27 Left 1116994627 14:51309819-51309841 CCAAAGTCATTAATTACATAAAT No data
Right 1116994630 14:51309869-51309891 CTTTCTTAAGAAACCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116994630 Original CRISPR CTTTCTTAAGAAACCACAGT GGG Intergenic