ID: 1116995501

View in Genome Browser
Species Human (GRCh38)
Location 14:51319499-51319521
Sequence TGACCTTTGTTAACAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116995501_1116995505 -3 Left 1116995501 14:51319499-51319521 CCACCTCCTGTTAACAAAGGTCA No data
Right 1116995505 14:51319519-51319541 TCATTTAAGGTCACCATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116995501 Original CRISPR TGACCTTTGTTAACAGGAGG TGG (reversed) Intergenic
No off target data available for this crispr