ID: 1116996533

View in Genome Browser
Species Human (GRCh38)
Location 14:51330571-51330593
Sequence TTCCCATGACTGCTCAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116996533_1116996538 -3 Left 1116996533 14:51330571-51330593 CCTGTCTTGAGCAGTCATGGGAA No data
Right 1116996538 14:51330591-51330613 GAACTGGGGGACGCCGTGCAAGG No data
1116996533_1116996539 -2 Left 1116996533 14:51330571-51330593 CCTGTCTTGAGCAGTCATGGGAA No data
Right 1116996539 14:51330592-51330614 AACTGGGGGACGCCGTGCAAGGG No data
1116996533_1116996540 2 Left 1116996533 14:51330571-51330593 CCTGTCTTGAGCAGTCATGGGAA No data
Right 1116996540 14:51330596-51330618 GGGGGACGCCGTGCAAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116996533 Original CRISPR TTCCCATGACTGCTCAAGAC AGG (reversed) Intergenic
No off target data available for this crispr