ID: 1116999444

View in Genome Browser
Species Human (GRCh38)
Location 14:51357250-51357272
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116999444_1116999447 0 Left 1116999444 14:51357250-51357272 CCTACATAATTAGAGGCCTGCAG No data
Right 1116999447 14:51357273-51357295 GAGATTCACATTCCTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116999444 Original CRISPR CTGCAGGCCTCTAATTATGT AGG (reversed) Intergenic
No off target data available for this crispr