ID: 1117001597

View in Genome Browser
Species Human (GRCh38)
Location 14:51376285-51376307
Sequence AGTTATCTGCAGAAGATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117001597_1117001604 23 Left 1117001597 14:51376285-51376307 CCTGTGATCTTCTGCAGATAACT No data
Right 1117001604 14:51376331-51376353 TTGGTGGGTTTACTGGGCTTTGG No data
1117001597_1117001598 4 Left 1117001597 14:51376285-51376307 CCTGTGATCTTCTGCAGATAACT No data
Right 1117001598 14:51376312-51376334 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1117001597_1117001600 7 Left 1117001597 14:51376285-51376307 CCTGTGATCTTCTGCAGATAACT No data
Right 1117001600 14:51376315-51376337 TTTTGAGAGACAGCTCTTGGTGG No data
1117001597_1117001601 8 Left 1117001597 14:51376285-51376307 CCTGTGATCTTCTGCAGATAACT No data
Right 1117001601 14:51376316-51376338 TTTGAGAGACAGCTCTTGGTGGG No data
1117001597_1117001605 26 Left 1117001597 14:51376285-51376307 CCTGTGATCTTCTGCAGATAACT No data
Right 1117001605 14:51376334-51376356 GTGGGTTTACTGGGCTTTGGTGG No data
1117001597_1117001602 16 Left 1117001597 14:51376285-51376307 CCTGTGATCTTCTGCAGATAACT No data
Right 1117001602 14:51376324-51376346 ACAGCTCTTGGTGGGTTTACTGG No data
1117001597_1117001603 17 Left 1117001597 14:51376285-51376307 CCTGTGATCTTCTGCAGATAACT No data
Right 1117001603 14:51376325-51376347 CAGCTCTTGGTGGGTTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117001597 Original CRISPR AGTTATCTGCAGAAGATCAC AGG (reversed) Intergenic
No off target data available for this crispr