ID: 1117003287

View in Genome Browser
Species Human (GRCh38)
Location 14:51393551-51393573
Sequence CTGTGGGAATGCTGGGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117003287_1117003296 30 Left 1117003287 14:51393551-51393573 CCCATGGCCCAGCATTCCCACAG 0: 1
1: 0
2: 1
3: 25
4: 265
Right 1117003296 14:51393604-51393626 TCAAGACTAGGAAAGTTACAGGG 0: 1
1: 1
2: 1
3: 19
4: 268
1117003287_1117003295 29 Left 1117003287 14:51393551-51393573 CCCATGGCCCAGCATTCCCACAG 0: 1
1: 0
2: 1
3: 25
4: 265
Right 1117003295 14:51393603-51393625 CTCAAGACTAGGAAAGTTACAGG 0: 1
1: 0
2: 1
3: 71
4: 275
1117003287_1117003293 18 Left 1117003287 14:51393551-51393573 CCCATGGCCCAGCATTCCCACAG 0: 1
1: 0
2: 1
3: 25
4: 265
Right 1117003293 14:51393592-51393614 AGTCTCTATTCCTCAAGACTAGG 0: 1
1: 0
2: 0
3: 15
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117003287 Original CRISPR CTGTGGGAATGCTGGGCCAT GGG (reversed) Intergenic
900336136 1:2164768-2164790 CTGTGCGATTGCCGGGCCTTGGG + Intronic
900651938 1:3734097-3734119 CTGCAGGAATGCTCTGCCATGGG + Exonic
901819339 1:11816696-11816718 CTGGAGGGATGGTGGGCCATAGG + Intronic
904475103 1:30759812-30759834 GTTTGGGAATCCTGGGGCATGGG + Intergenic
904764405 1:32832573-32832595 ATGTAGGAATACTGGGCAATGGG - Intronic
904800868 1:33092287-33092309 CTGTGGGGAGGCTGGGCTGTGGG + Intronic
905326862 1:37159229-37159251 CTGTGTGAATGCTGAGCTGTTGG - Intergenic
907338945 1:53719820-53719842 CAGTGGGATTGCTGGATCATAGG - Intronic
908721350 1:67129481-67129503 CAGAGGAAATTCTGGGCCATGGG + Intronic
910847057 1:91613793-91613815 CTTTGGGAAGGCTGGTCCCTGGG - Intergenic
911143807 1:94533439-94533461 CTGTGGTAGTGCTGGCCCAAGGG + Intronic
911219538 1:95233295-95233317 CAGTGGGAATCCTTGGCCTTTGG - Intronic
913393437 1:118340102-118340124 CAGTGGGAATTCTGGGGCAAAGG + Intergenic
914502200 1:148257107-148257129 CAATGGGAATGTTGGGACATAGG - Intergenic
920104170 1:203538938-203538960 CTCTGGGAATACTGAGCCAAAGG - Intergenic
921053377 1:211526727-211526749 GGGTGGGAATGCAGGGCCATTGG + Intergenic
922618300 1:226976228-226976250 CTGTGGGACTGCGGGGCTGTGGG + Intronic
922618339 1:226976380-226976402 CTGTGGGACTGCGGGGCTGTGGG + Intronic
922720286 1:227896797-227896819 GTGTGGGAGGGCTGGCCCATGGG - Intergenic
922783684 1:228272688-228272710 CTCTGTGGGTGCTGGGCCATGGG + Intronic
922873410 1:228921089-228921111 CTGTGGGATTGTTTGGCCCTGGG + Intergenic
924091023 1:240500872-240500894 CGGTGGAAATGCTGGGTCACAGG + Intronic
1062906010 10:1180185-1180207 CTGTGGGAATCCTGGGACCTGGG + Exonic
1062906054 10:1180314-1180336 CTGTGGGAATCCTGGGACCCGGG + Exonic
1062906084 10:1180400-1180422 CTGTGGGAATCCTGGGACCCGGG + Exonic
1063120021 10:3099001-3099023 CTCGGGAAACGCTGGGCCATAGG + Intronic
1063669249 10:8086619-8086641 CTGTGGGAATTCTGGGCACCAGG + Intergenic
1065629609 10:27664630-27664652 CTGTGGGATTGCTGAGTAATTGG + Intergenic
1067479974 10:46588278-46588300 CTGTGGGGAGGGTGGGCCATGGG - Intronic
1067614763 10:47753519-47753541 CTGTGGGGAGGGTGGGCCATGGG + Intergenic
1067756408 10:49009044-49009066 CTGTGGGACAGCTTGGCCCTGGG + Intergenic
1069025550 10:63536979-63537001 TTGTGGGATTGCTGGGTTATAGG - Intronic
1069664099 10:70143606-70143628 GTGTGAGGATGCTGGGCCTTTGG - Intronic
1069864540 10:71493517-71493539 CTGGGGAAATGCTGGGCCAGGGG - Intronic
1071630169 10:87213482-87213504 CTGTGGGGAGGGTGGGCCATGGG + Intergenic
1074891001 10:117736608-117736630 CTGTGGCACAGCTGGGCCCTAGG + Intergenic
1075418436 10:122282843-122282865 CTCTGGGGATGCTGGGCCAGTGG - Intronic
1076303011 10:129442025-129442047 CTGTGGGATCCTTGGGCCATAGG - Intergenic
1076708814 10:132319689-132319711 CTGTGGGAATGCAGGGGCTGAGG + Intronic
1077509055 11:2946085-2946107 CTGGGGGTAGGCTGGGCCCTTGG + Intronic
1077629618 11:3802301-3802323 TTCTGGGAATGATGAGCCATGGG - Intronic
1079332117 11:19542126-19542148 CTGTGGCTGTGCTGGGCCAGAGG - Intronic
1079529523 11:21433397-21433419 TATTGGGAATGCTGGGTCATAGG + Intronic
1081303625 11:41484685-41484707 CTGAGGGATTGCTGGGGCTTTGG - Intergenic
1081461045 11:43273286-43273308 CTGTGGAAAAGGTGGCCCATGGG - Intergenic
1082889708 11:58125865-58125887 CTTTGGGAATGGTGAGCCAGTGG - Intronic
1083410823 11:62491200-62491222 CTATGGAAATCCTGGGTCATAGG - Intronic
1084171763 11:67404375-67404397 CTGGCGGAATGCTGGGACAGAGG + Intronic
1084476578 11:69392738-69392760 GAGTGGGCTTGCTGGGCCATAGG - Intergenic
1084772038 11:71349610-71349632 CTGTGGGGATGGCAGGCCATTGG + Intergenic
1089376161 11:117996255-117996277 CGGTGGGGATGCTGCGCCACTGG + Intronic
1089895110 11:121922474-121922496 CTGTGAGAGTGCTGGGGCAGGGG + Intergenic
1090463090 11:126909416-126909438 CTGTGGGTATGCTGGGAGCTGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091265560 11:134268583-134268605 CTATGGGACTGCTGGGTCACTGG + Intergenic
1092167685 12:6352950-6352972 CTGTGGGACAGCTGGGCCCAGGG + Intronic
1092237864 12:6821337-6821359 CTGTGTGAGGGCTGGGCCTTGGG - Intergenic
1094719954 12:33052975-33052997 CTGTGGCAAGGCCGGGCCAAGGG - Intergenic
1094861607 12:34473453-34473475 ATGTGGGAACTCTGGGCCAATGG - Intergenic
1096045709 12:48560314-48560336 GTGGGGGCATCCTGGGCCATAGG + Intergenic
1097818153 12:64098325-64098347 GTGTGAGAATGCAGGGCCAGGGG - Intronic
1099103551 12:78473240-78473262 CCGTGGGAAGGCTGTGCCAAAGG - Intergenic
1099791329 12:87338509-87338531 AACTGGGAATGCTGGGGCATGGG - Intergenic
1102776553 12:115524744-115524766 CAGTGGGGATTCAGGGCCATGGG + Intergenic
1103793478 12:123487787-123487809 GAGTGGGATTGCTGGGTCATGGG + Intronic
1103798273 12:123520060-123520082 GAGTGGAATTGCTGGGCCATAGG - Intronic
1104733441 12:131121735-131121757 CTGTGGGGAGGCTGGGCCCAGGG + Intronic
1104819950 12:131671235-131671257 AAGTGGGATTGCTGGGTCATAGG - Intergenic
1107655565 13:42589409-42589431 CTATGGGAAGGATGGGCCAGTGG - Intronic
1109863996 13:68238124-68238146 CTCTTGACATGCTGGGCCATAGG + Intergenic
1110911202 13:80966327-80966349 GTGTGGGAAAGCTTGGCCCTGGG - Intergenic
1111595803 13:90408469-90408491 CAGTGGGATTGCTGGATCATAGG + Intergenic
1112137929 13:96603580-96603602 AAGTGGAATTGCTGGGCCATAGG + Intronic
1112440956 13:99424535-99424557 ATTGGGGAATGCTGGGCCACAGG + Intergenic
1113042366 13:106119014-106119036 CTGTGGGAATGCTGTCAGATAGG - Intergenic
1113768622 13:112895189-112895211 CTGCGGGAGGGCTGGGCCAGAGG + Intronic
1113902542 13:113804904-113804926 TGGTGGGACGGCTGGGCCATAGG - Exonic
1114988834 14:28263022-28263044 CAGTGGGTATGCTCAGCCATGGG - Intergenic
1115342938 14:32311568-32311590 CTGAGGGAACACTGGGGCATAGG - Intergenic
1115432974 14:33342486-33342508 ATGTGGAAAGGCTGGGCCAGAGG - Intronic
1115454533 14:33586764-33586786 ATTTGGCATTGCTGGGCCATTGG + Intronic
1116253473 14:42518001-42518023 CTGTGGGAACCATGGGCCCTAGG - Intergenic
1117003287 14:51393551-51393573 CTGTGGGAATGCTGGGCCATGGG - Intergenic
1117971091 14:61251721-61251743 CAGTGGGATTGCTGGACCATAGG + Intronic
1119532480 14:75372613-75372635 CTGGGAAAATGCTGTGCCATTGG + Intergenic
1121560344 14:94870125-94870147 GAGTGGGATTGCTGGGTCATAGG + Intergenic
1122165037 14:99816582-99816604 CAGTGGGATTCCTGGTCCATAGG + Intronic
1122299828 14:100725301-100725323 ATGTGGGAAGGCAGGCCCATGGG - Intergenic
1122973747 14:105162757-105162779 CTGTGGGTACACTGGGCCATGGG - Intronic
1127896454 15:63303930-63303952 GAGTGGGACTGCTGGGTCATGGG + Intronic
1128072136 15:64804401-64804423 CTGTGGGAATGCAGAGCTAGGGG - Intergenic
1128345266 15:66849212-66849234 GTGTGGGAATGCTGGGCTCCTGG - Intergenic
1129727252 15:77907747-77907769 CTGTGGGGAGGGTGGGGCATAGG + Intergenic
1129840628 15:78741271-78741293 CTGTGGGGAGGGTGGGGCATAGG - Intergenic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130555914 15:84922471-84922493 CTGTGGGAATGCTGATAGATTGG - Intronic
1131027680 15:89158533-89158555 CAGTGGCAGTGCTGGGGCATCGG - Intronic
1131098065 15:89668436-89668458 GAGTGGAACTGCTGGGCCATAGG + Intronic
1132370766 15:101296226-101296248 GAGTGGGACTGCTGGGACATAGG + Intergenic
1136158422 16:28401467-28401489 CTGTGGGGAGGCTGGGTGATAGG - Intronic
1136204665 16:28713816-28713838 CTGTGGGGAGGCTGGGTGATAGG + Intronic
1136297508 16:29312095-29312117 CTGTGGGGCTGCAGGGCCTTGGG - Intergenic
1137800916 16:51261327-51261349 GTCTGGAAATGCTGGGTCATGGG + Intergenic
1138139429 16:54555285-54555307 GGATGGGAATGCTGGGACATAGG - Intergenic
1139720778 16:68851686-68851708 AAGTGGGATTGCTGGGCCAAAGG + Intronic
1140495598 16:75384571-75384593 AAGTGGGATTGCTGGGTCATTGG - Intronic
1141244936 16:82297104-82297126 CTGTGGGATTGCTGGGTCAAAGG + Intergenic
1141883552 16:86875825-86875847 CAGTGGAATTGCTGGGTCATAGG - Intergenic
1142433727 16:90044259-90044281 TTGTGGGGAGGCTGGGCCAAGGG - Exonic
1142806881 17:2376000-2376022 CTGTGGGGATGCTGAGAAATGGG - Intronic
1143727480 17:8859391-8859413 GTGTGCTAATGGTGGGCCATAGG - Intronic
1146596843 17:34176825-34176847 CTGTGGCACTGCTGGGCAAAAGG - Intergenic
1147898802 17:43770098-43770120 GAGTGGGATTGCTGGGCCAGAGG - Intronic
1148819647 17:50353227-50353249 CGGTGGGAGTGCTGGGTCTTAGG + Intronic
1149987567 17:61359159-61359181 CTGAGGGAACACTGGGCCAGAGG - Intronic
1151114249 17:71716105-71716127 CTGTGGTGATCCTGGGCCAGTGG + Intergenic
1151215672 17:72575052-72575074 CTGGAGGAGTGTTGGGCCATGGG - Intergenic
1151224561 17:72638982-72639004 CTGTGGGGATGCTGGGATACAGG + Intergenic
1152200736 17:78944453-78944475 CTGAGGGAGACCTGGGCCATGGG - Intergenic
1152450976 17:80379855-80379877 CTGTGTGACTGCTGGGACTTTGG - Intronic
1152465953 17:80466302-80466324 CCATGGGAACGCTGGGCCTTGGG - Intergenic
1153508879 18:5831466-5831488 CTGTGGGGCTGCGGGGCCCTGGG - Intergenic
1154213139 18:12396876-12396898 CTGTTGGAGTGGTGGGCGATTGG + Intergenic
1155708545 18:28847172-28847194 CAGTGGGTATGCTCAGCCATGGG - Intergenic
1157311889 18:46559215-46559237 CTGTGGGTCAGCTGGCCCATGGG + Exonic
1158526974 18:58223854-58223876 CTTGGGGAATTCTGGGCCACTGG - Intronic
1158788295 18:60742427-60742449 CTGTGGGAAGTCTGGTCCTTGGG - Intergenic
1159091513 18:63854346-63854368 CAGTGGGATTGCTGGATCATAGG + Intergenic
1159815175 18:73065078-73065100 AAGTTGGATTGCTGGGCCATAGG + Intergenic
1161658508 19:5530919-5530941 CTTTGGGCATGCTGGGTCCTTGG + Intergenic
1162489795 19:10985384-10985406 CCTTGGGAGTGCTGGTCCATGGG - Exonic
1162796513 19:13090151-13090173 CAGTGGGAAGGATGGGCCAGAGG - Intronic
1164413262 19:28022811-28022833 CTGTGGGAGATCTGGGCCAGGGG - Intergenic
1166146425 19:40839780-40839802 CGGTGGGATTGCTGGATCATAGG + Intronic
1166150470 19:40870389-40870411 CAGTGGGATTGCTGGATCATAGG + Intronic
1166266066 19:41685261-41685283 CTGTGTAAATGCTTGGCCATGGG - Intronic
1166827416 19:45617997-45618019 ATGTGGGAATGCTGGGACAAAGG + Intronic
1168638692 19:58016050-58016072 GTGTGGCATTGCTGGGCCACAGG - Intergenic
925184223 2:1836196-1836218 CTGTTGGAATCTTGGGCCACAGG - Intronic
926666872 2:15534857-15534879 AAGTGGGATTGCTGGGTCATAGG - Intronic
926874269 2:17457568-17457590 CTGTGGGCATGCTGGGTTTTGGG - Intergenic
926893308 2:17657733-17657755 GAGTGGGAATGCTGGGACAGAGG - Intergenic
929474919 2:42236672-42236694 CAGTGGAATTGCTGGGTCATAGG + Intronic
932931831 2:76050480-76050502 TTGTGGGAAGGCTGGCCTATGGG + Intergenic
933089573 2:78104152-78104174 CTCTGGGACTTCTGGGTCATGGG + Intergenic
936888677 2:117343079-117343101 ATGTGGGATTGCTGGGTCATAGG - Intergenic
937116637 2:119409944-119409966 CGGTGGGATTGCTGGATCATAGG + Intergenic
938857428 2:135328259-135328281 CAGTGAGAATGCTTGGACATAGG - Intronic
946401783 2:219472173-219472195 CTGTGGGGCTGTTGGGCCCTTGG + Intronic
947581463 2:231321777-231321799 CTGTGGTACTGCTGGGGCACTGG + Intronic
948566131 2:238887604-238887626 CTGTGGTTAGGCAGGGCCATAGG + Intronic
949044608 2:241866708-241866730 CTGTGGGACTGCAGGGCCTGGGG + Intergenic
1169274448 20:4224248-4224270 CTGTTGAAATGCAGGGCAATGGG + Intronic
1169737963 20:8857578-8857600 CTGTGGAATTACTGGGCCATAGG + Intronic
1170219873 20:13930376-13930398 CTGTGGCACTTCAGGGCCATGGG + Intronic
1172785799 20:37467887-37467909 GAGTGGGATTGCTGGGTCATGGG - Intergenic
1173132513 20:40408092-40408114 CCCTGGGAATGCTGAGCCCTGGG + Intergenic
1173177204 20:40773412-40773434 CTGGGAGAATGCTGGTCCTTAGG + Intergenic
1173779012 20:45737715-45737737 AAGTGGGATTGCTGGGTCATAGG - Intergenic
1173888491 20:46482715-46482737 CTGTGTCATTGATGGGCCATGGG - Intergenic
1175823359 20:61923785-61923807 CTGGGGGAATTCTGGGCTGTGGG - Intronic
1175838117 20:62009312-62009334 CTCTTGGAACCCTGGGCCATGGG + Intronic
1177137815 21:17325315-17325337 CAGTGGGATTGCTGGATCATAGG - Intergenic
1178369056 21:32011828-32011850 TTGTGGGAATGCTGTGCCAGGGG + Intronic
1181028827 22:20140418-20140440 CTGTGGGATTTCTGGGTCACTGG - Intronic
1181083510 22:20428861-20428883 CTGGGGGAATGCGTGGCCACGGG - Intronic
1183432929 22:37776405-37776427 GAGTGGAAATGCTAGGCCATAGG - Exonic
1183758397 22:39792255-39792277 TAGTGGGATTGCTGGGCCAATGG + Intronic
1184554007 22:45223032-45223054 CTGTGGGATCGCTGGGTCAGAGG - Intronic
1184986619 22:48140351-48140373 CTGTGGGCAGGCTGAGCCAGGGG + Intergenic
1185374872 22:50477876-50477898 ATGTGCGAGGGCTGGGCCATAGG - Intergenic
949753343 3:7379830-7379852 CTGTGGGAATACTGCACCCTGGG - Intronic
950135552 3:10578286-10578308 GAGTGGGATTGCTGGGCCATAGG - Intronic
950596007 3:13982306-13982328 CAGTGGGATTGCTGGATCATTGG + Intronic
950693538 3:14680124-14680146 AAGTGGGATTGCTGGGTCATGGG - Intronic
951566437 3:24016749-24016771 CTGTGGGATTTCTGGGAGATTGG + Intergenic
953019325 3:39103859-39103881 CTGTGGGAATGCTGCTCTAGAGG + Intronic
953795647 3:45983954-45983976 CTGTGGCCATGCTAGGCCAATGG + Intronic
958809781 3:98847649-98847671 TTGTGAGAATGCTGGGCACTGGG - Intronic
959948831 3:112155473-112155495 CTGTGTGTATGTTGGGCTATTGG + Intronic
960064663 3:113357814-113357836 TTGTGGAACTGCTGGGCCATAGG - Intronic
960907914 3:122620189-122620211 GTGTGGGAAAGCTGTGCCACAGG + Intronic
962839150 3:139217890-139217912 CTGTGAGGATGCTGGGGCAAAGG - Intronic
963536234 3:146531913-146531935 ATGTGGGAAAGCTGAGGCATAGG - Intronic
964727163 3:159825504-159825526 CTGTGGGAAAGCTGGTCAAGTGG - Intronic
965361564 3:167746903-167746925 CAGTGGAACTGCTGGGTCATAGG - Intronic
965807361 3:172555945-172555967 CAGTGGAATTGCTGGGCCAAGGG - Intergenic
966500465 3:180633884-180633906 CAGTGGGTATGCTCAGCCATGGG - Intronic
966739742 3:183221566-183221588 CTGTGGGAAAGCTGGAACCTAGG + Intronic
970708714 4:18836554-18836576 TTGTGAGAATCCTGAGCCATTGG + Intergenic
972125522 4:35760548-35760570 CAGTGGGAATGTTCAGCCATAGG - Intergenic
975375585 4:73640397-73640419 CTGTGGGATTGCTGGGTCATAGG + Intergenic
976343782 4:83975876-83975898 GGGTGGGATTGCTGGGTCATAGG + Intergenic
977002227 4:91518821-91518843 CAGTGGGTATGCTCAGCCATGGG + Intronic
977827568 4:101551827-101551849 CTGTGGGCAGCGTGGGCCATGGG - Intronic
981337265 4:143581496-143581518 CAGTGGGAATGCTCAGCCAGGGG - Intronic
982076241 4:151739829-151739851 CTATAGGAATGCTCAGCCATGGG - Intronic
984634705 4:182098306-182098328 CAGTGGGATTGCTGGATCATAGG - Intergenic
985591355 5:767036-767058 CCCAGGCAATGCTGGGCCATTGG - Intergenic
987323825 5:16794594-16794616 CGGAGGGACTCCTGGGCCATGGG + Intronic
991410080 5:66336966-66336988 GTATGGGCCTGCTGGGCCATAGG + Intergenic
991734850 5:69622374-69622396 CTCTGGGAAAGCTGGGGCAGAGG - Intergenic
991780128 5:70124344-70124366 CTCTGGGAAAGCTGGGGCAGAGG + Intergenic
991811284 5:70477509-70477531 CTCTGGGAAAGCTGGGGCAGAGG - Intergenic
991859415 5:70999773-70999795 CTCTGGGAAAGCTGGGGCAGAGG + Intronic
991872575 5:71124667-71124689 CTCTGGGAAAGCTGGGGCAGAGG + Intergenic
993413723 5:87601156-87601178 CAGTGGGTATGCTGAGCCATGGG + Intergenic
995106792 5:108383990-108384012 ATGTGGGATTGCTGGCTCATAGG - Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
996748105 5:126863536-126863558 CAGTGGGAGTGCTGGGTTATTGG - Intergenic
998449403 5:142222713-142222735 CTGGAGGAATTCCGGGCCATGGG + Intergenic
999782775 5:154863824-154863846 CTGTGGAACAGCTGGGCCCTAGG - Intronic
1002387027 5:178875908-178875930 CAGTGGGAATGCTCAGCCAGGGG + Intronic
1002858485 6:1058734-1058756 AAGTGGAAATGCTGGGTCATAGG - Intergenic
1005394739 6:25369623-25369645 CTGCAGGAAGGCTGGGCCTTTGG + Intronic
1005648609 6:27865805-27865827 CTGCGGGAGAGCTGGGCCACTGG + Intergenic
1006400537 6:33814703-33814725 CTGTGGGCAGCCAGGGCCATGGG + Intergenic
1007049144 6:38808320-38808342 CTGTAGGGATGAGGGGCCATGGG - Intronic
1007070934 6:39037727-39037749 CTGTGGGACAGCTGGCCCAGAGG + Intergenic
1007363950 6:41376880-41376902 CAGTGGAACTGCTGGGTCATAGG - Intergenic
1007408031 6:41646033-41646055 CAGTGGGCATGCTGGGCTGTGGG + Intronic
1008536137 6:52507745-52507767 CTGTGGGACTCGTGGGACATGGG - Intronic
1014797677 6:125745873-125745895 GTGTGAGAATGCTGCGCCCTAGG - Intergenic
1016076849 6:139805526-139805548 CTGTGGGGATGGGGGGCCAGGGG + Intergenic
1016615331 6:146041478-146041500 CTGTGGGAAACCTGGGCCTAGGG - Intronic
1016957711 6:149642411-149642433 GAGTGGGATTGCTGGGTCATGGG - Intronic
1017677547 6:156829330-156829352 CTGTGGGCCTGGAGGGCCATAGG - Exonic
1019384541 7:747140-747162 GCGTGGGGTTGCTGGGCCATAGG + Intronic
1019385434 7:753148-753170 CTGTGGAAGGGCTGGGCCACAGG - Intronic
1020007118 7:4788964-4788986 CTGTGGGAATGGGGGGCCCCAGG - Intronic
1021695251 7:23269955-23269977 CCGTGGGAATGCTGCGACAGGGG - Exonic
1022889326 7:34680515-34680537 GTATGGAAATGCTGGGACATGGG - Intronic
1022992997 7:35726688-35726710 GTGAGGGAAAGCTGGTCCATTGG - Intergenic
1024996042 7:55273804-55273826 CAGGGGAAATGCTGGGCCCTTGG + Intergenic
1025011010 7:55398544-55398566 CTGTGGGGATGCTGGCCCCCTGG + Exonic
1025065643 7:55853151-55853173 CAGTGGGATTGCTGGATCATAGG - Intronic
1025280254 7:57621691-57621713 CTGTGTGAGGGCTGGGCAATAGG + Intergenic
1025304479 7:57843810-57843832 CTGTGTGAGGGCTGGGCAATAGG - Intergenic
1025919359 7:65896406-65896428 GAGTGGGACTGCTGGGTCATAGG + Intronic
1026360031 7:69595309-69595331 GCGTGGAACTGCTGGGCCATAGG + Intergenic
1029687166 7:102156863-102156885 CTCTCTGAATGCTGGGCCATAGG - Intronic
1029945693 7:104530410-104530432 CTGTGGCTTTGCTGGGCCCTGGG - Intronic
1030372389 7:108715086-108715108 CTGTGTGGCTTCTGGGCCATGGG + Intergenic
1031499203 7:122491625-122491647 CTTGGGGAATGCTGGATCATAGG - Intronic
1032282012 7:130511470-130511492 CTGTGGGAATGCTGTACAAATGG + Intronic
1032601428 7:133300324-133300346 CAGTGGCAAAGCTTGGCCATAGG + Intronic
1032690175 7:134277600-134277622 GTGTGGGAATGCTGGGGGAGGGG + Intergenic
1032794938 7:135269626-135269648 CAGTGGGAAGGCAGGGCCAAGGG + Intergenic
1033160266 7:138990082-138990104 TAGTGGGATTGCTGGACCATAGG + Intergenic
1033452335 7:141473007-141473029 GTGTGGGTGTGCTGGGCGATAGG + Exonic
1036176889 8:6547781-6547803 CGGTGGGAATGCGGGGCCAGGGG + Intronic
1036935457 8:12997767-12997789 GAGTGGGGTTGCTGGGCCATAGG + Intronic
1040820681 8:51553187-51553209 CTTTGGGTGTGCTGAGCCATAGG - Intronic
1041012715 8:53559772-53559794 CAGTGGGAATGCTCAGCCATGGG - Intergenic
1041154434 8:54970658-54970680 CAGTAGGATTGCTGGGTCATAGG - Intergenic
1041470480 8:58203171-58203193 CTGAGGAAATGGGGGGCCATTGG - Intronic
1041817481 8:61991368-61991390 AAGTGGGAATGCTTGGTCATAGG + Intergenic
1042534019 8:69840890-69840912 CTGTGGGACTTGTGGGGCATGGG + Intergenic
1046913369 8:119653307-119653329 ATGTGGGATTGCTGGGGCAGAGG - Intronic
1047697221 8:127415914-127415936 CGGTGGGGGTGATGGGCCATGGG + Exonic
1047742769 8:127820126-127820148 CTGTGGGAGTGCTGGACCGCTGG - Intergenic
1047768146 8:128006202-128006224 AAGTGGGATTGCTGGGCCAAAGG - Intergenic
1047847064 8:128817917-128817939 CTGAGGAAACGCTTGGCCATGGG + Intergenic
1049311158 8:141934649-141934671 CTCTGGGGCTGCTGGGCCAATGG + Intergenic
1051201641 9:14633355-14633377 CAGTGGGAATGTTGGGCAGTAGG - Intronic
1051625983 9:19100551-19100573 CAGTGGGATTGCTGGATCATAGG - Intronic
1052311757 9:27075650-27075672 CTCTGGGAGTGCTGTGCCAGGGG + Intergenic
1052831710 9:33221294-33221316 CTGTGGGCAGGTTGGGCCTTGGG - Intronic
1056767691 9:89454989-89455011 CTGCAGGGCTGCTGGGCCATGGG - Intronic
1057083369 9:92188883-92188905 CTGTGGGAATGAGGGACCAGGGG + Intergenic
1059086749 9:111311236-111311258 CAGTGGGATTGCTGGATCATAGG + Intergenic
1059189280 9:112308268-112308290 CTTTGGGAATCCTAGGCCAGAGG - Intronic
1060438301 9:123615384-123615406 CTGTGGGAATGCTGGTCTCCAGG - Intronic
1060542079 9:124438017-124438039 GTGTCGGGGTGCTGGGCCATGGG - Intergenic
1061058178 9:128235681-128235703 AAGTGGAAATGCTGGGCCATAGG + Intronic
1061079181 9:128360143-128360165 CTGTGGCAAAGTTGGGGCATGGG - Intronic
1061497980 9:130986507-130986529 CTCGGGGCAAGCTGGGCCATGGG + Intergenic
1062007607 9:134249036-134249058 TGGTGGGATTGCTGGGCCTTGGG - Intergenic
1062511340 9:136907826-136907848 CTGAGGGGATGCTCTGCCATGGG - Intronic
1062635006 9:137486071-137486093 CTGTGAGAGGGCTGGGCCACGGG - Intronic
1185850672 X:3483213-3483235 CAGTGGGATTGATGGGCCATAGG + Intergenic
1186560755 X:10610277-10610299 AAGTGGGATTGCTGGGCCAAAGG - Intronic
1187137768 X:16564861-16564883 CAGTGGAATTGCTGGGCCATGGG - Intergenic
1188597050 X:31914354-31914376 CAGTGGGATTGCTGGATCATAGG - Intronic
1192891801 X:75398718-75398740 CTGTGGGAGTGCTGTCCCAGGGG - Intronic
1195722804 X:107882842-107882864 CTTTGGGATTGCTGGGTAATGGG - Intronic
1195819815 X:108931722-108931744 AAGTGGGATTGCTGGGTCATAGG + Intergenic
1195885375 X:109632002-109632024 GTGTGGAAATGCTGGGTCATGGG + Intronic
1198274995 X:135091765-135091787 GAGTGGAAATGCTGGGCTATAGG + Intergenic
1199153560 X:144519099-144519121 CAATGGGATTGCTGGGTCATAGG + Intergenic
1200041131 X:153370350-153370372 CAGTGGAACTGCTGGGTCATAGG + Intergenic
1201365685 Y:13204364-13204386 CTGTGGACAGGCTGGGGCATGGG - Intergenic