ID: 1117007217

View in Genome Browser
Species Human (GRCh38)
Location 14:51433323-51433345
Sequence CTCCATGTATAAATGAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117007217_1117007219 26 Left 1117007217 14:51433323-51433345 CCATGGTTCATTTATACATGGAG No data
Right 1117007219 14:51433372-51433394 GAAAATCTCTCTGAAATAATAGG No data
1117007217_1117007218 4 Left 1117007217 14:51433323-51433345 CCATGGTTCATTTATACATGGAG No data
Right 1117007218 14:51433350-51433372 ATATATCTGTAAAAAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117007217 Original CRISPR CTCCATGTATAAATGAACCA TGG (reversed) Intergenic
No off target data available for this crispr