ID: 1117011132

View in Genome Browser
Species Human (GRCh38)
Location 14:51471895-51471917
Sequence CCTTATAAAGGGCTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117011122_1117011132 14 Left 1117011122 14:51471858-51471880 CCAAGAAATGATATAAGAATATT No data
Right 1117011132 14:51471895-51471917 CCTTATAAAGGGCTGGAGGAGGG No data
1117011121_1117011132 15 Left 1117011121 14:51471857-51471879 CCCAAGAAATGATATAAGAATAT No data
Right 1117011132 14:51471895-51471917 CCTTATAAAGGGCTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117011132 Original CRISPR CCTTATAAAGGGCTGGAGGA GGG Intergenic
No off target data available for this crispr