ID: 1117018276

View in Genome Browser
Species Human (GRCh38)
Location 14:51541500-51541522
Sequence TAGGATTCAATGGCGGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117018267_1117018276 27 Left 1117018267 14:51541450-51541472 CCCTATAGTAAAATGAAATAAAA 0: 1
1: 1
2: 28
3: 379
4: 3109
Right 1117018276 14:51541500-51541522 TAGGATTCAATGGCGGGGTAGGG 0: 1
1: 0
2: 1
3: 6
4: 84
1117018268_1117018276 26 Left 1117018268 14:51541451-51541473 CCTATAGTAAAATGAAATAAAAA 0: 1
1: 1
2: 17
3: 248
4: 2209
Right 1117018276 14:51541500-51541522 TAGGATTCAATGGCGGGGTAGGG 0: 1
1: 0
2: 1
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117018276 Original CRISPR TAGGATTCAATGGCGGGGTA GGG Intronic
904310224 1:29624552-29624574 TAGGATCCAAGGGCGGGGAAGGG + Intergenic
912815131 1:112822920-112822942 TAGGTTTCAATGGGATGGTAAGG + Intergenic
916261651 1:162848287-162848309 TAGGATTAAATGGCAAAGTATGG + Intronic
919756962 1:201072258-201072280 GAGGAAACAATGGTGGGGTAGGG - Intronic
1065779501 10:29153823-29153845 TAGGATTCAATGAGGTTGTAAGG - Intergenic
1071550665 10:86564011-86564033 TAGGTTTTAATGGGGTGGTAAGG + Intergenic
1072936561 10:99718818-99718840 TAGCACTCAGTGGCGGGGTGAGG - Intronic
1074623035 10:115146537-115146559 TAATATTCAATGGCAGTGTAGGG - Intronic
1081840646 11:46199049-46199071 TAGGAGGCAATGGCGGGGGAAGG - Intergenic
1093147125 12:15580215-15580237 TAGAATTCAATTGCTGGGTTGGG - Intronic
1095778249 12:46032754-46032776 TAGGTTTTAATGGGAGGGTAAGG - Intergenic
1095998902 12:48112905-48112927 TAGGTTTTAATGGGAGGGTAAGG + Intronic
1096183733 12:49565314-49565336 CAGGATGCAATGGCAGGGTTGGG + Intronic
1105572762 13:21619506-21619528 TAGGAAGGATTGGCGGGGTAAGG - Intergenic
1108880610 13:55109530-55109552 TAGTATTCAATAGCACGGTAGGG + Intergenic
1110188927 13:72707212-72707234 TAGGACTTAATGGCAGGTTATGG - Intergenic
1111311011 13:86486080-86486102 TGGGAGTCGATGGTGGGGTATGG + Intergenic
1114901608 14:27067378-27067400 CAGGAGTAAATGGCGGGGTCAGG - Intergenic
1117018276 14:51541500-51541522 TAGGATTCAATGGCGGGGTAGGG + Intronic
1117705781 14:58466204-58466226 TAAAATTCAATGGCTGGGCACGG - Intronic
1117887320 14:60378984-60379006 AAGGATTCAATAGTGGGGTCTGG - Intergenic
1118190327 14:63574341-63574363 TATGATGCAATGGCCGGGTGTGG - Intergenic
1120087416 14:80289512-80289534 TAGGAATGAATGGAGGAGTAAGG - Intronic
1122192328 14:100055403-100055425 TAGGAATAAATAGCAGGGTATGG - Intronic
1125002777 15:34788585-34788607 TAGGATACAATGGGGTGGTGGGG + Exonic
1126897266 15:53272356-53272378 TAGCACTCAATGGAGGGCTATGG + Intergenic
1127974421 15:63986614-63986636 TGGGAATCATTGGCGGGGTAGGG - Intronic
1132071761 15:98784223-98784245 TAGGATTCAGGGGCCGGGCACGG - Intronic
1145288566 17:21524250-21524272 GAGGATTAAATGGCGGCGGAGGG - Intergenic
1145335649 17:21910202-21910224 TAGGATGGAATGGAGGGGAATGG + Intergenic
1146949356 17:36894899-36894921 CAGGACTCTTTGGCGGGGTAAGG - Intergenic
1151055384 17:71024910-71024932 TAGTATTTAATGGCTGGGTTGGG + Intergenic
1155021319 18:21899741-21899763 TACTAGTCAATGGCGGAGTATGG - Intergenic
1155196081 18:23476075-23476097 TAACATTCAATGGCTGGGTGTGG - Intronic
1155339516 18:24799621-24799643 TAGGATTTAATGGAGGGGTAGGG - Intergenic
1159168085 18:64726665-64726687 TGGGATTGAATGGCTAGGTAAGG + Intergenic
1161626339 19:5329104-5329126 CGGGAGGCAATGGCGGGGTAGGG + Intronic
1165407746 19:35641460-35641482 AAGGATTCAATGAAGGGGTATGG + Intergenic
1165425297 19:35742256-35742278 TAGGATTCAAAGGTGAGGTGAGG - Intronic
1167032297 19:46970953-46970975 GAGGATCCAATGGCAGGGGATGG - Intronic
1167045580 19:47046919-47046941 AAGGATTCAAGGGCCGGGTGTGG + Intronic
928835644 2:35541380-35541402 TAGCATACAATGGCTGGGCATGG - Intergenic
931038461 2:58269085-58269107 TATGAATCAGTGGGGGGGTAGGG - Intergenic
938585462 2:132686059-132686081 TAGTACCCAATGGCTGGGTAGGG + Intronic
938724507 2:134095572-134095594 TAGTATTCTATGGTGGGGTAGGG + Intergenic
940280509 2:151984136-151984158 TAGGTTTAAATGGCTGGTTAGGG - Intronic
943353427 2:186822067-186822089 TAGGATTTAATGGTTTGGTAAGG + Intergenic
944529355 2:200652072-200652094 TAGGAACAAATGGCAGGGTAGGG + Intronic
948715658 2:239859965-239859987 TAAGATTCAAAGGCTGGGTGTGG + Intergenic
1170003399 20:11639806-11639828 TAGTATTCAATAGCAGAGTAGGG + Intergenic
1171914510 20:31052987-31053009 TAGAATGCAATGGAAGGGTATGG + Intergenic
1171915191 20:31057346-31057368 TAGAATGCAATGGAAGGGTATGG + Intergenic
1173612027 20:44375954-44375976 TAGGATTCTAGGGCCGGGCATGG + Intronic
1183487334 22:38096362-38096384 TATGATAAAATGGCTGGGTATGG + Intronic
1184469884 22:44690403-44690425 AAGGATTCCATGGTGGGGTTGGG + Intronic
953985354 3:47437871-47437893 TAGGATGAAATGGCTGGGTATGG + Intronic
954057208 3:48037035-48037057 TAAGAATCAATGACAGGGTAGGG - Intronic
960834337 3:121889629-121889651 TGGAATGCAATGGCGGGGTCTGG + Intergenic
961319704 3:126064134-126064156 AAGGGGTCAATGGTGGGGTAAGG + Intronic
962316129 3:134360580-134360602 TAGGATTCAGGGCAGGGGTATGG - Intronic
963874868 3:150463740-150463762 GATGATTCCATGGCGGGGTTCGG - Exonic
971761158 4:30767191-30767213 AATGATTCAATAGCAGGGTATGG + Intronic
974994887 4:69142846-69142868 TAGTGTTTAATGGCTGGGTAAGG - Intronic
982720725 4:158856976-158856998 TAGAATTCAGTGGAGGGTTATGG + Intronic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
984259873 4:177432186-177432208 TAGGGAGCAATGGTGGGGTATGG - Intronic
984730346 4:183062603-183062625 TAGGTCACAATGGCGGGGAATGG + Intergenic
991621264 5:68547682-68547704 TAGGAATCACTGGTGGGGAAAGG - Intergenic
992881661 5:81116371-81116393 TGGCATTCACTGGCTGGGTATGG - Intronic
1000554452 5:162707684-162707706 TAGGACACACTGGCAGGGTAGGG + Intergenic
1000885207 5:166741866-166741888 TAGGTTTCAATGGGATGGTAAGG + Intergenic
1002093015 5:176815809-176815831 TATGTGTCAATGGCGGGGGAGGG - Intronic
1003604802 6:7549437-7549459 TAAGATTCACTAGCCGGGTACGG - Intronic
1004946946 6:20625956-20625978 TAGAATTTAATGGCTGGGGATGG - Intronic
1005053766 6:21710599-21710621 TAGGATTGCATGTCAGGGTAAGG - Intergenic
1007653592 6:43438550-43438572 TAGGAGTCAAGGGCTGGGCATGG + Intronic
1009573725 6:65424453-65424475 TAGGTTTCAATGGCCGTGAAAGG - Intronic
1017405064 6:154110596-154110618 TAGGACTCATTGGCCGGGCACGG + Intronic
1018871918 6:167790233-167790255 TAGGATTGGATGGTGGGGTTGGG - Intronic
1019960576 7:4456162-4456184 TCGGATTCTATGGATGGGTAGGG - Intergenic
1032204868 7:129853727-129853749 CAGAAATCAATGGCGGGGAAGGG + Intronic
1032612108 7:133425796-133425818 TAGAAATGAATGGCGGGGTTAGG - Intronic
1040011475 8:42664661-42664683 TAGTATTCAATGGTGCAGTAGGG - Intergenic
1048665023 8:136651260-136651282 TCTGATTCAATGGAGGGTTAGGG + Intergenic
1062440841 9:136568618-136568640 GAGGAGTCATGGGCGGGGTAGGG + Intergenic
1189889310 X:45582485-45582507 TATGATTCATTGGGGGGGTGGGG - Intergenic
1193372567 X:80714275-80714297 TAGAATGCAATGGCGTGATATGG + Intronic
1195899764 X:109785505-109785527 TAGGATGTAATGGAGGGGCACGG + Intergenic
1198494105 X:137173411-137173433 TTTGATTCAATGTTGGGGTAGGG - Intergenic
1199612540 X:149631001-149631023 TTGGAGTCAGTGTCGGGGTATGG - Intronic
1200112312 X:153747321-153747343 AAGCATTCACTGGCGGGGGAGGG + Intergenic
1201097400 Y:10631890-10631912 TAGGACACAATGGCGTGGAAAGG - Intergenic