ID: 1117024339

View in Genome Browser
Species Human (GRCh38)
Location 14:51604981-51605003
Sequence TGTGATCTCAAGATACATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117024335_1117024339 17 Left 1117024335 14:51604941-51604963 CCTGAGATTATATCGTTGAAGTG 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1117024339 14:51604981-51605003 TGTGATCTCAAGATACATGAGGG 0: 1
1: 0
2: 1
3: 11
4: 179
1117024334_1117024339 22 Left 1117024334 14:51604936-51604958 CCAGTCCTGAGATTATATCGTTG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 1117024339 14:51604981-51605003 TGTGATCTCAAGATACATGAGGG 0: 1
1: 0
2: 1
3: 11
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117024339 Original CRISPR TGTGATCTCAAGATACATGA GGG Intronic
902791763 1:18773720-18773742 TGTGACCTCAAGGTACTAGAAGG + Intergenic
904670019 1:32157351-32157373 TGTGATCACAAGAGAGATGGTGG + Exonic
905079946 1:35309671-35309693 TGCGATCTCAAAATACTTTATGG + Intronic
908589075 1:65609487-65609509 TGTGATCTAATGATACAATAAGG - Intronic
910318022 1:85911148-85911170 TGTGATCTGAAGAGAAAAGATGG - Intronic
911408444 1:97471170-97471192 TTTGATCTCATTATACATAATGG - Intronic
911469930 1:98305715-98305737 TGTGATCTGAAGACCCCTGAAGG - Intergenic
911791199 1:102017359-102017381 TGAGATCACAAGATACATGTGGG + Intergenic
915010209 1:152678465-152678487 GGTGATCTCAAGATGCCTGATGG + Intergenic
919011868 1:191975069-191975091 TGAGTTCTCAAGAGACCTGATGG - Intergenic
920754904 1:208719901-208719923 TGGGAACTCAAGAAAGATGAAGG + Intergenic
922255187 1:223887474-223887496 TGTGAGCTAAAGATTCATAATGG + Intergenic
923403892 1:233641972-233641994 TGTCATCTCAAGTTTGATGAGGG + Intronic
1065698184 10:28399662-28399684 TGTGATCACCAGATTCCTGATGG + Intergenic
1065878722 10:30021027-30021049 TGTAATCTAAAGACACTTGATGG - Intronic
1067827000 10:49583360-49583382 TGTGTTCTCACGATATCTGATGG - Intergenic
1068158206 10:53228590-53228612 TGAGTTCTCAAGATATCTGATGG - Intergenic
1068249221 10:54415006-54415028 TGTGATATCAAGTTACATAAAGG + Intronic
1068521059 10:58077970-58077992 TGGGAATTCAAGCTACATGAAGG - Intergenic
1069252474 10:66286988-66287010 TCTGATTTCAAATTACATGAAGG - Intronic
1069862049 10:71477610-71477632 AGTGCTCTCAGGATACAGGATGG - Intronic
1071802006 10:89073920-89073942 TGTAGTCTCAAGAGACAGGACGG + Intergenic
1072211128 10:93248042-93248064 TGTTATCCCAAGAGAAATGAGGG - Intergenic
1073967656 10:109009861-109009883 TGTATACTAAAGATACATGAGGG + Intergenic
1074619914 10:115107935-115107957 TGTGATCTCAGGATCCTAGATGG + Intronic
1075365058 10:121879379-121879401 TGTGCTAGCAAGATACATGGAGG - Intronic
1076378375 10:130008164-130008186 TTTAATATCAAGATAGATGAGGG + Intergenic
1078124376 11:8545674-8545696 TTTGGTCTCAAGAAACATAAAGG + Intronic
1081387461 11:42488587-42488609 TGCCATATCAAGATGCATGAAGG + Intergenic
1086565698 11:88223684-88223706 TCTGATCTCAAGGTGCATGCTGG + Intergenic
1089923715 11:122235202-122235224 TGTGATCATAAGATTCCTGAGGG + Intergenic
1092442068 12:8513424-8513446 AGTGATCTCAACATACTTGTGGG + Intronic
1094805235 12:34083888-34083910 TCAGATCTCAAGCTACATGCTGG - Intergenic
1095248698 12:39953479-39953501 TGTGATATAAAGATTAATGATGG - Intronic
1096955247 12:55518973-55518995 TCAGATCTCAAGATGCATGCTGG - Intergenic
1097461123 12:59863176-59863198 TGTGATATCAAGAAAGCTGAGGG - Intergenic
1099371066 12:81830191-81830213 TGTGACCTCAGAATACATGGTGG - Intergenic
1099631903 12:85160231-85160253 TGTTATCTGAAAATACATTAGGG + Intronic
1100168162 12:91941752-91941774 TGTCTTCTCGAGTTACATGAAGG - Intergenic
1101412459 12:104480843-104480865 TGTGGTCTCCAGAACCATGAAGG + Intronic
1103137555 12:118520617-118520639 TGTGACCTCCAGCAACATGACGG + Intergenic
1104531914 12:129579941-129579963 TGTGATCTCAGGGTGCAGGAGGG + Intronic
1106189379 13:27437892-27437914 TGTGATCTCAGGATAGGGGATGG + Intronic
1106660807 13:31797984-31798006 TGTGATCTCTAGATTCCAGAAGG - Intronic
1107200704 13:37713660-37713682 AGTGATCTGAACATACATAATGG + Intronic
1114506099 14:23215137-23215159 TGAGTTCTCATGAGACATGATGG + Intronic
1114798754 14:25746439-25746461 TGTGGTTTCAAGATAAATTAAGG + Intergenic
1116696254 14:48182226-48182248 TGAGATCTCATGATATCTGATGG + Intergenic
1117024339 14:51604981-51605003 TGTGATCTCAAGATACATGAGGG + Intronic
1119122692 14:72093926-72093948 TGTAAACTCATGATAAATGAAGG - Intronic
1120012336 14:79430983-79431005 TGTGTGCTCAAAATATATGAGGG - Intronic
1120221477 14:81739045-81739067 CATGATGTCATGATACATGAAGG + Intergenic
1120797087 14:88645895-88645917 TGTGAACTCAATATACCTGTTGG - Intronic
1121046643 14:90793062-90793084 TGTGTTCTCACGAGACCTGATGG + Intronic
1124432218 15:29617568-29617590 TGCGATATTAAGAAACATGATGG + Intergenic
1126719891 15:51567394-51567416 TGTTATCTAAAGGTACATAAGGG - Intronic
1127118335 15:55749072-55749094 TGTGATCTCAAGATGCTTACTGG - Intergenic
1127717232 15:61660977-61660999 TGTGATTTCAATATAAATGTCGG - Intergenic
1130822255 15:87508003-87508025 TGTGATCAAGAGATACAGGAAGG - Intergenic
1132890575 16:2202413-2202435 TGAGATCTCAAGAGATCTGATGG - Intergenic
1141764184 16:86047788-86047810 TGTATACTCAAGATAAATGAAGG + Intergenic
1142921856 17:3195349-3195371 TATGATCTCAAAATGCAAGATGG + Intergenic
1147895988 17:43751709-43751731 TGGGACCTGAAGATACAGGATGG - Intergenic
1150598120 17:66625045-66625067 TGTGATCTATAGAAAGATGAAGG - Intronic
1151074560 17:71256098-71256120 TGTGATCCTAAGATACCTGAAGG - Intergenic
1160095562 18:75869221-75869243 TGAGATCTTAATAGACATGATGG - Intergenic
1160628849 18:80231384-80231406 TGTGAGCTCATGATACATGGAGG + Intronic
925291880 2:2753417-2753439 TGTAATCACAAAATACGTGAAGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927523692 2:23718833-23718855 TGTGATCTGAAGATGGAAGAAGG - Intergenic
928747815 2:34435453-34435475 TGGGATCCCAAGAGACATCATGG - Intergenic
928773071 2:34725204-34725226 TATAAACACAAGATACATGAAGG - Intergenic
928777373 2:34781669-34781691 TGTGATGGCAGGATATATGATGG + Intergenic
930996425 2:57724343-57724365 TGACATCTCAAAATACATCATGG - Intergenic
931673810 2:64673217-64673239 TGTGCTCTGAAGATGCAGGAAGG - Intronic
932149825 2:69360685-69360707 TGTAATCTCAAGACACTGGAAGG - Intronic
935043824 2:99461149-99461171 TGTCATCTCAAAATAAATGCTGG - Intronic
935340446 2:102055053-102055075 TGTGATCACAAAGTTCATGATGG + Intergenic
937507279 2:122551348-122551370 TCTGATCTCAAGCTCCATGCTGG - Intergenic
937755314 2:125530426-125530448 TGTAATCAAAAGACACATGAAGG + Intergenic
940749247 2:157606160-157606182 TGTGATATATATATACATGATGG - Intronic
943220252 2:185094677-185094699 TGAGTTCTCATGATACCTGATGG + Intergenic
945336747 2:208601036-208601058 TGAGTTCTCAAGAGACCTGATGG - Intronic
946677058 2:222171310-222171332 TGAGCTCTCAAGATATCTGATGG + Intergenic
948292536 2:236836721-236836743 GGAGTTCTCATGATACATGATGG - Intergenic
1169920001 20:10725168-10725190 TGTGATATGCAGATACATAAGGG + Intergenic
1170105256 20:12748339-12748361 TGTGATATCAAGAAACATCTTGG + Intergenic
1170747674 20:19115224-19115246 TGAGTTCTCATGAGACATGATGG + Intergenic
1173449032 20:43146155-43146177 TGTAATCTCAAGAAAAATGTAGG - Intronic
1178560919 21:33639033-33639055 TGAGATCTAAAGATAGATAAAGG + Intronic
1180013099 21:45064289-45064311 TGTGTTTTACAGATACATGAGGG + Intergenic
1181341992 22:22188491-22188513 TCAGATCTCAAGCTACATGCTGG - Intergenic
953464844 3:43110415-43110437 TGAGATCTCACGAGACCTGATGG + Intergenic
955528885 3:59851661-59851683 CGTGTTCTCAAGAGACAAGAGGG + Intronic
955962195 3:64352077-64352099 TGTGAACTGAGGATACATGATGG + Intronic
956253094 3:67254629-67254651 TGAGTTCTCAAGAGATATGATGG + Intergenic
957885107 3:86277314-86277336 TGTGATTTTAAAATACATGCTGG + Intergenic
958751871 3:98201580-98201602 TGTGCTTCCAAAATACATGATGG + Intergenic
960102034 3:113753909-113753931 TTTTTTCTTAAGATACATGATGG - Intronic
962040065 3:131697768-131697790 TGTGATCACAAAATACTTAAGGG - Intronic
962090116 3:132234504-132234526 TGTGATCTCATGATAGCAGAAGG - Intronic
964966051 3:162495264-162495286 TGAGTTCTCATGAGACATGATGG - Intergenic
965379584 3:167971605-167971627 TGTGAGCTCCAAATTCATGAAGG + Intergenic
965685755 3:171300552-171300574 TGTGCTTTCAATATAAATGATGG + Intronic
965727832 3:171737891-171737913 AGCGATCCCAAGATACAAGAAGG - Exonic
965923017 3:173942492-173942514 TCTGAGCTCAGGATACATGCTGG - Intronic
967445650 3:189563247-189563269 TGTGAGGTCAAGAGACAAGAAGG - Intergenic
968854251 4:3107081-3107103 TGTGATCATAAGAGAAATGAAGG + Intronic
969641065 4:8399085-8399107 TGTGAGCTCATGATTCCTGAGGG + Intronic
971496390 4:27270375-27270397 TGTGATCTTAAAATATTTGAGGG - Intergenic
973229637 4:47826535-47826557 TGTGCTTTGAAGATACAGGAAGG - Intronic
973548710 4:52009056-52009078 TGTGATCTTAAGATATATACTGG + Intronic
974122392 4:57655298-57655320 TGTGAGCTCAAGAGAGATGCTGG - Intergenic
974334422 4:60522283-60522305 TGTAAAATCAAGATTCATGAGGG - Intergenic
975975078 4:80086244-80086266 AGTGGTGTCAAGATACATCAAGG - Intronic
976033456 4:80787078-80787100 AATGCTCTCAAGATACAGGAGGG + Intronic
976591861 4:86857343-86857365 TGTGATCTCATGATAAATGAAGG + Intergenic
976615772 4:87074770-87074792 TGTGATCTCAGGATATATAATGG + Intronic
977379392 4:96252334-96252356 TGAGTTCTCAAGAGACCTGATGG + Intergenic
977431368 4:96934223-96934245 TGTGATTTCAAAATACTTAAAGG - Intergenic
978278533 4:106981184-106981206 TGTGCCCTAAAGATACTTGAAGG + Intronic
980292984 4:130869600-130869622 TGAGTTCTCAAGAGACCTGATGG + Intergenic
980560145 4:134461248-134461270 TGTGTTCTCAAGAGATCTGATGG + Intergenic
980564825 4:134526079-134526101 TGAGATCTAAAGTTGCATGATGG + Intergenic
981929594 4:150175396-150175418 TGTGGTCTCCAGATTCAGGAGGG + Intronic
983317305 4:166148750-166148772 TGAGTTCTCAAGAGACCTGATGG + Intergenic
984824326 4:183910934-183910956 TGTTATTTTAAGAGACATGAGGG + Intronic
987004110 5:13691976-13691998 TGTGATGTCAAGTAACATGTGGG - Exonic
988032916 5:25788756-25788778 TTTGATCTCGAGATACATTGTGG - Intergenic
988111686 5:26830757-26830779 TGAGTTCTCAAGAGACCTGATGG + Intergenic
989165229 5:38427096-38427118 TGTGATCTCAAATTCCATGAAGG - Exonic
991204656 5:64037245-64037267 GGTGATCACAAGATACGAGAGGG - Intergenic
992381897 5:76245763-76245785 TCTGATCTAAAGATACTTAAAGG + Intronic
993661863 5:90647433-90647455 TGTGATCTGAAAATATGTGATGG + Intronic
994067294 5:95557221-95557243 TGTGGTCTCTAAATACAAGATGG - Intronic
1000917554 5:167100489-167100511 TGTGGTCTCAAGAAAAATGAAGG - Intergenic
1001160336 5:169307003-169307025 TGTGTTCTCATGATACCTGATGG + Intergenic
1008228667 6:48955898-48955920 AGTGATCTTAAGAAACATGCAGG - Intergenic
1008576109 6:52861475-52861497 TCAGATCTCAAGCTACATGCTGG - Intronic
1008952734 6:57178144-57178166 TGAGATATTAAGAAACATGAAGG + Intronic
1009285535 6:61811657-61811679 TGAGATATCAAGAAACATGTTGG - Intronic
1011933539 6:92743833-92743855 TGTGTTCTCAAGAGATCTGATGG + Intergenic
1012394113 6:98776101-98776123 TGTGATATCAAGAAAGAAGAGGG - Intergenic
1012531349 6:100241357-100241379 TGTGATCGCAACATCCAAGATGG - Intergenic
1013018992 6:106191583-106191605 TCTAATCTCCAGTTACATGAAGG + Intronic
1013987188 6:116208943-116208965 TGTGATTAAAAGATACATAAAGG + Intronic
1014043089 6:116851661-116851683 TGAGATCTCATGAGATATGATGG + Intergenic
1015759330 6:136641608-136641630 TGTAATCTCAAGATCAATGCAGG + Intronic
1016017037 6:139197131-139197153 TGTGATCTAGAGATAACTGAAGG - Intergenic
1021323345 7:19238970-19238992 TGAGTTCTCAAGAGATATGATGG - Intergenic
1026136913 7:67671579-67671601 TGTGTTCTCAGGACACATGTAGG + Intergenic
1027991135 7:85361730-85361752 TGTGTTCTCAAGAGAGCTGATGG + Intergenic
1032749938 7:134829025-134829047 TTTTATTTCAAGATACATGTTGG + Intronic
1033371607 7:140714086-140714108 TCAGATCTCAAGCTACATGCTGG + Intronic
1036626091 8:10472782-10472804 AGTAATTTCAAGATAGATGATGG + Intergenic
1039419845 8:37427389-37427411 GGTGAAGTCAAGAAACATGAAGG + Intergenic
1040061971 8:43111582-43111604 TGAGATCTCAAGCTGCATGCTGG - Intronic
1040598811 8:48864852-48864874 TGTGATATCATGATGCAAGAGGG + Intergenic
1043164079 8:76881522-76881544 TGTGATTTCAAGATAAATACAGG + Intergenic
1044332061 8:90932021-90932043 TGTGATCTGATGATACACTAAGG - Intronic
1046081539 8:109375981-109376003 TCTGATCTCAAGCTGCATGCTGG + Intronic
1046813437 8:118557204-118557226 TGAGTTCTCAAGAGACCTGATGG + Intronic
1049808677 8:144553397-144553419 TGTGTTCTCATGATACGTGGAGG - Intronic
1053608931 9:39690733-39690755 TGAGTTCTCAAGAGACCTGATGG + Intergenic
1053866776 9:42447001-42447023 TGAGTTCTCAAGAGACCTGATGG + Intergenic
1054244591 9:62651665-62651687 TGAGTTCTCAAGAGACCTGATGG - Intergenic
1054558718 9:66686208-66686230 TGAGTTCTCAAGAGACCTGATGG - Intergenic
1054782318 9:69176393-69176415 TGAGATCTAAAGATACAAGTAGG + Intronic
1059664763 9:116436268-116436290 TGTGATCTAAAGATTCTTGAGGG + Intronic
1060251906 9:121993534-121993556 GGTGATATCAAGATAAATCATGG - Intronic
1060991875 9:127854192-127854214 CGTGAGCTCAGGATACAGGAAGG + Intronic
1062429472 9:136520613-136520635 TGTGGTCCCAAGCTACTTGAGGG + Intronic
1187440629 X:19315279-19315301 TGTGGTGTATAGATACATGATGG - Intergenic
1190225878 X:48544641-48544663 TGTGACCTCCAGATACAAGCAGG + Intronic
1190465645 X:50723120-50723142 TGTGATGTCAAGGGAAATGATGG + Intronic
1192029626 X:67495392-67495414 TGAGTTCTCATGATACCTGATGG + Intergenic
1192946879 X:75973271-75973293 TGTGATCTCATTATACATTTTGG - Intergenic
1193293479 X:79805942-79805964 TGTGATCTAAATAAACTTGAAGG - Intergenic
1194187177 X:90786643-90786665 TGTGTTCTCATGAGACCTGATGG - Intergenic
1194672918 X:96756418-96756440 TGTGATTTCAAGATTCATCCAGG + Intronic
1194716840 X:97296305-97296327 TTAGATCACAAGATAAATGAAGG - Intronic
1196676807 X:118428729-118428751 TGTGTTATAAAGATACATGCAGG + Intronic
1196699779 X:118655457-118655479 GGTGATGTTAAGACACATGACGG - Intronic
1197786485 X:130202511-130202533 TGTGATCTTAATAGTCATGAAGG - Intergenic
1197850152 X:130849982-130850004 TGTGTTCACAGGATCCATGAAGG - Intronic
1198854820 X:141004708-141004730 GGTCTTCTCAGGATACATGAGGG + Intergenic
1198877194 X:141240436-141240458 GGTCTTCTCAGGATACATGAGGG - Intergenic
1198907873 X:141582658-141582680 GGTCTTCTCAGGATACATGAGGG - Intergenic
1198908918 X:141591766-141591788 GGTCTTCTCAGGATACATGAGGG + Intronic
1198918159 X:141696389-141696411 GGTCTTCTCAGGATACATGAGGG - Intronic
1200533769 Y:4368694-4368716 TGTGTTCTCATGAGACCTGATGG - Intergenic
1201603300 Y:15755907-15755929 TCTGATGTCTACATACATGAAGG + Intergenic