ID: 1117024715

View in Genome Browser
Species Human (GRCh38)
Location 14:51607810-51607832
Sequence CGTGGCACTCGGCAGAAACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117024715_1117024721 5 Left 1117024715 14:51607810-51607832 CCCGGTTTCTGCCGAGTGCCACG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1117024721 14:51607838-51607860 CTTGCGGTTGCGGTTCCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 12
1117024715_1117024724 21 Left 1117024715 14:51607810-51607832 CCCGGTTTCTGCCGAGTGCCACG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1117024724 14:51607854-51607876 CGTCAGGAATCCCTGACTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 132
1117024715_1117024723 20 Left 1117024715 14:51607810-51607832 CCCGGTTTCTGCCGAGTGCCACG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1117024723 14:51607853-51607875 CCGTCAGGAATCCCTGACTCTGG 0: 1
1: 0
2: 1
3: 5
4: 94
1117024715_1117024720 -5 Left 1117024715 14:51607810-51607832 CCCGGTTTCTGCCGAGTGCCACG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1117024720 14:51607828-51607850 CCACGCTGTGCTTGCGGTTGCGG 0: 1
1: 0
2: 1
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117024715 Original CRISPR CGTGGCACTCGGCAGAAACC GGG (reversed) Intronic