ID: 1117024715

View in Genome Browser
Species Human (GRCh38)
Location 14:51607810-51607832
Sequence CGTGGCACTCGGCAGAAACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117024715_1117024721 5 Left 1117024715 14:51607810-51607832 CCCGGTTTCTGCCGAGTGCCACG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1117024721 14:51607838-51607860 CTTGCGGTTGCGGTTCCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 12
1117024715_1117024720 -5 Left 1117024715 14:51607810-51607832 CCCGGTTTCTGCCGAGTGCCACG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1117024720 14:51607828-51607850 CCACGCTGTGCTTGCGGTTGCGG 0: 1
1: 0
2: 1
3: 7
4: 77
1117024715_1117024724 21 Left 1117024715 14:51607810-51607832 CCCGGTTTCTGCCGAGTGCCACG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1117024724 14:51607854-51607876 CGTCAGGAATCCCTGACTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 132
1117024715_1117024723 20 Left 1117024715 14:51607810-51607832 CCCGGTTTCTGCCGAGTGCCACG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1117024723 14:51607853-51607875 CCGTCAGGAATCCCTGACTCTGG 0: 1
1: 0
2: 1
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117024715 Original CRISPR CGTGGCACTCGGCAGAAACC GGG (reversed) Intronic
904279803 1:29410948-29410970 TGTGGCACTCAGCAGACACCAGG - Intergenic
910244393 1:85123051-85123073 TGTGGCTCTTGTCAGAAACCTGG + Intronic
915778563 1:158519233-158519255 CGTTGCACTAGGCAGAGATCAGG + Intergenic
920217152 1:204368976-204368998 CCTGCCACTCTGCAGAACCCAGG - Intronic
923054487 1:230415672-230415694 CGTTGCACTGTTCAGAAACCAGG + Intronic
1065660066 10:27997801-27997823 CTTGGCAATGGGCAGAAACCGGG - Intronic
1068533430 10:58213745-58213767 AGTGGCCTTAGGCAGAAACCAGG + Intronic
1071435058 10:85641146-85641168 CCTGGCACTGGGCAGAAATTGGG + Intronic
1073207567 10:101776718-101776740 CGGGGCACGCGGCCGAAACAGGG - Intronic
1073768718 10:106711488-106711510 AGTGGCACTCTGCAGAATACAGG - Intronic
1078610426 11:12814545-12814567 CATGGCACTAGGCAGAGCCCTGG - Intronic
1078923312 11:15851522-15851544 AGGGGCACTTGGAAGAAACCAGG - Intergenic
1090866551 11:130705748-130705770 CGGGGCAGTTGGCAGAAACTTGG + Intronic
1092268102 12:6998985-6999007 CTTGGCACTTGGCAGTGACCTGG + Intronic
1102680654 12:114688253-114688275 TGGGGCACTGGGCAGAAACGAGG - Intergenic
1103050384 12:117774387-117774409 CTTGGCATTCAGCAGAACCCTGG + Intronic
1104702603 12:130918505-130918527 CGTTGCACTCGTCAGGAACGTGG + Intergenic
1113868594 13:113544658-113544680 CATGGCCCTCGCCAGACACCTGG - Intronic
1117024715 14:51607810-51607832 CGTGGCACTCGGCAGAAACCGGG - Intronic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1118017308 14:61673127-61673149 GGTGGCACTCGGCAGGCTCCTGG - Intergenic
1119184355 14:72629492-72629514 CCTGGCACTTGGGAGCAACCTGG - Intronic
1121176199 14:91892432-91892454 CCTGGCAGTAGGTAGAAACCAGG - Intronic
1124712860 15:32030137-32030159 CTGGGCACTCGGGAGAAAGCCGG - Intergenic
1131076072 15:89495788-89495810 CGTGGCTCTTGCCACAAACCAGG - Intronic
1131753662 15:95537386-95537408 CCTGGCACTCCACAGATACCCGG + Intergenic
1139559062 16:67730219-67730241 TCTGACACTTGGCAGAAACCAGG - Intronic
1141006896 16:80360798-80360820 CTTGGCACTCAGCACATACCTGG + Intergenic
1141133755 16:81452414-81452436 CTAGGCACTCGGAAGAAAACAGG + Intronic
1142517366 17:441440-441462 GGAGGCCATCGGCAGAAACCCGG + Exonic
1144519702 17:15945542-15945564 CGTGGCAGTCGACAGATACCTGG + Exonic
1151340356 17:73467004-73467026 CCTGGCACACGGAAGAACCCTGG + Intronic
1152944303 17:83190766-83190788 AGTGGCACTCAGCAGGAACTGGG - Intergenic
1157555027 18:48607800-48607822 GGTGTCACTCAGCAGAAACTCGG - Intronic
1160369974 18:78363811-78363833 CGTGACACTCGACACAAACCGGG - Intergenic
1160811342 19:1014254-1014276 CGTGGAACCAGGCAGCAACCTGG - Exonic
925262748 2:2542570-2542592 CCTGGCACTCAGCAGAACCCAGG + Intergenic
927199930 2:20571819-20571841 AGTGGCACTGGGGAGATACCAGG - Intronic
927492701 2:23531115-23531137 TCTGGGACTCGGCAGAAGCCTGG + Intronic
930527559 2:52548871-52548893 CTTGGCACTGGGCAGTAATCTGG + Intergenic
934068796 2:88364744-88364766 CCTGGCCCTCAGCTGAAACCAGG - Intergenic
934636370 2:95992656-95992678 CTTGGCACTCTGCAGCCACCGGG + Intergenic
934836132 2:97590669-97590691 CTTGGCACTCCGCAGCCACCGGG + Intergenic
946294663 2:218774370-218774392 CGTGACACCAGGCAGAAACAAGG + Intergenic
947664293 2:231893787-231893809 AGTAGGACTCAGCAGAAACCTGG + Intergenic
947868719 2:233420082-233420104 CGTGGCAGTCGGCAGGGGCCTGG + Intronic
1179165448 21:38931987-38932009 CCTGGCAACCGCCAGAAACCAGG + Intergenic
1179641844 21:42752887-42752909 TCTAGCTCTCGGCAGAAACCAGG + Intronic
967020903 3:185521578-185521600 CCTGGCACTGCACAGAAACCAGG + Intronic
970695971 4:18677590-18677612 GGTGGTACTCAGCAGAGACCTGG + Intergenic
971496201 4:27268190-27268212 CGTGACACACGACAGAAATCCGG - Intergenic
972427181 4:38944532-38944554 CGTGGCACTGGTTAGGAACCAGG + Exonic
972573149 4:40328901-40328923 GGAGGCACTAGGCAGAACCCAGG + Intergenic
984785813 4:183566348-183566370 GGTGGCCCTAGGCAGAAACAGGG + Intergenic
990130699 5:52579573-52579595 TGAGGCACTTGTCAGAAACCGGG - Intergenic
995751170 5:115454774-115454796 CGTGGCACTCAGAAGAACACTGG + Intergenic
997727509 5:136133531-136133553 CATGGCAAGTGGCAGAAACCAGG - Intronic
1000552567 5:162685162-162685184 TATGGCACCCAGCAGAAACCAGG + Intergenic
1006077765 6:31545401-31545423 GGTGGCCCTAGGCAGAAATCCGG + Exonic
1010551741 6:77231782-77231804 TGTGGCAATCGGCTGAAACTGGG + Intergenic
1033145535 7:138867742-138867764 GGTGGCACTCGGCAGCACCCTGG + Intronic
1047184257 8:122617599-122617621 CGTGGCAGTTGGCTGCAACCTGG - Intergenic
1049161847 8:141103005-141103027 AGTGGCACCGGGCAGAAGCCTGG - Intergenic
1051136337 9:13926211-13926233 GGTGGCACTAGGCAGGAACTTGG - Intergenic
1059544200 9:115160106-115160128 CATGGCACTCGGCAAATACCAGG - Intronic
1061250409 9:129423067-129423089 CGTGGCACCCAGCAGCAGCCGGG - Intergenic
1062393672 9:136343980-136344002 CCTGGCACACGGCAGGAGCCTGG - Intronic