ID: 1117024721

View in Genome Browser
Species Human (GRCh38)
Location 14:51607838-51607860
Sequence CTTGCGGTTGCGGTTCCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 12}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117024716_1117024721 4 Left 1117024716 14:51607811-51607833 CCGGTTTCTGCCGAGTGCCACGC 0: 1
1: 0
2: 0
3: 1
4: 72
Right 1117024721 14:51607838-51607860 CTTGCGGTTGCGGTTCCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 12
1117024708_1117024721 30 Left 1117024708 14:51607785-51607807 CCGGCCTTCCGGGTGGGGCCCCT 0: 1
1: 0
2: 0
3: 19
4: 240
Right 1117024721 14:51607838-51607860 CTTGCGGTTGCGGTTCCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 12
1117024712_1117024721 12 Left 1117024712 14:51607803-51607825 CCCCTTTCCCGGTTTCTGCCGAG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1117024721 14:51607838-51607860 CTTGCGGTTGCGGTTCCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 12
1117024714_1117024721 10 Left 1117024714 14:51607805-51607827 CCTTTCCCGGTTTCTGCCGAGTG 0: 1
1: 0
2: 1
3: 0
4: 80
Right 1117024721 14:51607838-51607860 CTTGCGGTTGCGGTTCCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 12
1117024709_1117024721 26 Left 1117024709 14:51607789-51607811 CCTTCCGGGTGGGGCCCCTTTCC 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1117024721 14:51607838-51607860 CTTGCGGTTGCGGTTCCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 12
1117024711_1117024721 22 Left 1117024711 14:51607793-51607815 CCGGGTGGGGCCCCTTTCCCGGT 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1117024721 14:51607838-51607860 CTTGCGGTTGCGGTTCCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 12
1117024715_1117024721 5 Left 1117024715 14:51607810-51607832 CCCGGTTTCTGCCGAGTGCCACG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1117024721 14:51607838-51607860 CTTGCGGTTGCGGTTCCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 12
1117024713_1117024721 11 Left 1117024713 14:51607804-51607826 CCCTTTCCCGGTTTCTGCCGAGT 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1117024721 14:51607838-51607860 CTTGCGGTTGCGGTTCCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 12
1117024717_1117024721 -6 Left 1117024717 14:51607821-51607843 CCGAGTGCCACGCTGTGCTTGCG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1117024721 14:51607838-51607860 CTTGCGGTTGCGGTTCCGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117024721 Original CRISPR CTTGCGGTTGCGGTTCCGTC AGG Intronic