ID: 1117024723

View in Genome Browser
Species Human (GRCh38)
Location 14:51607853-51607875
Sequence CCGTCAGGAATCCCTGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 94}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117024714_1117024723 25 Left 1117024714 14:51607805-51607827 CCTTTCCCGGTTTCTGCCGAGTG 0: 1
1: 0
2: 1
3: 0
4: 80
Right 1117024723 14:51607853-51607875 CCGTCAGGAATCCCTGACTCTGG 0: 1
1: 0
2: 1
3: 5
4: 94
1117024717_1117024723 9 Left 1117024717 14:51607821-51607843 CCGAGTGCCACGCTGTGCTTGCG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1117024723 14:51607853-51607875 CCGTCAGGAATCCCTGACTCTGG 0: 1
1: 0
2: 1
3: 5
4: 94
1117024713_1117024723 26 Left 1117024713 14:51607804-51607826 CCCTTTCCCGGTTTCTGCCGAGT 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1117024723 14:51607853-51607875 CCGTCAGGAATCCCTGACTCTGG 0: 1
1: 0
2: 1
3: 5
4: 94
1117024716_1117024723 19 Left 1117024716 14:51607811-51607833 CCGGTTTCTGCCGAGTGCCACGC 0: 1
1: 0
2: 0
3: 1
4: 72
Right 1117024723 14:51607853-51607875 CCGTCAGGAATCCCTGACTCTGG 0: 1
1: 0
2: 1
3: 5
4: 94
1117024719_1117024723 2 Left 1117024719 14:51607828-51607850 CCACGCTGTGCTTGCGGTTGCGG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1117024723 14:51607853-51607875 CCGTCAGGAATCCCTGACTCTGG 0: 1
1: 0
2: 1
3: 5
4: 94
1117024712_1117024723 27 Left 1117024712 14:51607803-51607825 CCCCTTTCCCGGTTTCTGCCGAG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1117024723 14:51607853-51607875 CCGTCAGGAATCCCTGACTCTGG 0: 1
1: 0
2: 1
3: 5
4: 94
1117024715_1117024723 20 Left 1117024715 14:51607810-51607832 CCCGGTTTCTGCCGAGTGCCACG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1117024723 14:51607853-51607875 CCGTCAGGAATCCCTGACTCTGG 0: 1
1: 0
2: 1
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117024723 Original CRISPR CCGTCAGGAATCCCTGACTC TGG Intronic