ID: 1117025277

View in Genome Browser
Species Human (GRCh38)
Location 14:51613254-51613276
Sequence GGTGACAAAGAAACACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 568}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117025277 Original CRISPR GGTGACAAAGAAACACAAAC AGG Intronic
900999497 1:6141705-6141727 GATGAGAAACAGACACAAACGGG + Intronic
901695798 1:11007069-11007091 GCAGAAAAAGAAACAAAAACAGG - Intergenic
901740628 1:11339523-11339545 AGGGACAAAGACACATAAACCGG + Intergenic
901826554 1:11865663-11865685 AGTAACAAAGAACCACAGACAGG + Intergenic
902799538 1:18820691-18820713 GGTGACACAGAAACACACACTGG + Intergenic
903087516 1:20875888-20875910 GGTGACAGAGCAAGACAAAAAGG + Intronic
903644587 1:24886911-24886933 TGTGACACAGAGCCACAAACTGG + Intergenic
904390238 1:30180180-30180202 GGTAACAAATTCACACAAACTGG - Intergenic
905241797 1:36586367-36586389 GGAGACAAAGACACGCAAAGAGG - Intergenic
905861736 1:41356646-41356668 TGTGATAAAGTACCACAAACTGG - Intergenic
906074544 1:43042309-43042331 CATAACAAAGGAACACAAACTGG + Intergenic
906115806 1:43356398-43356420 TGTAACAAAGTACCACAAACTGG - Intergenic
906167294 1:43696236-43696258 GGTCACTAAGTACCACAAACTGG + Intronic
906209945 1:44007201-44007223 GGTGTCACAGAGACACAAAGAGG - Intronic
906365033 1:45201299-45201321 TGTAACAAAGTATCACAAACTGG - Intronic
906699768 1:47849456-47849478 CGTAACAAAGAACCACAGACTGG - Intronic
907580964 1:55572383-55572405 TGTGACAAAAAACCATAAACTGG + Intergenic
907582832 1:55587420-55587442 TGTAACAAAGAACCACAAACTGG + Intergenic
907830217 1:58057745-58057767 CATGACAAAGTACCACAAACTGG - Intronic
908338182 1:63148717-63148739 GGTGGCAAAGAACCCCAACCAGG + Intergenic
908572323 1:65422494-65422516 CGTTACAAAGTACCACAAACTGG - Intronic
908572640 1:65425407-65425429 AGTGACAAAGACACAGAAAGAGG - Intronic
908822783 1:68104958-68104980 GGTAACAAAGAACCAGAGACAGG - Intronic
909199247 1:72668256-72668278 GGTGACATAAAAACACAATATGG - Intergenic
909477908 1:76103067-76103089 GGTGAAAAAGAAACAAAAATTGG - Intronic
909538902 1:76769140-76769162 TGTGACAAAGTACCACAAACTGG + Intergenic
909751971 1:79172616-79172638 GGTGCCAAAGGAACAAAAGCAGG - Intergenic
909888995 1:80979515-80979537 CGTGACACAGAGACACAAAGTGG + Intergenic
910273849 1:85427294-85427316 GGAGACAATGGAAAACAAACTGG + Intronic
910665619 1:89723161-89723183 CATGACAAAGTACCACAAACTGG + Intronic
910889344 1:92001064-92001086 GGAGACAAAAAAACACAGAGAGG - Intronic
910959550 1:92747387-92747409 TGTTACAAAGTACCACAAACTGG + Intronic
911530554 1:99038400-99038422 GGATACAAAGAAATACAAAGAGG - Intergenic
911573044 1:99540694-99540716 TGTAAAAAAGTAACACAAACTGG - Intergenic
911826924 1:102498708-102498730 TGTAACAAAGTAACAGAAACCGG + Intergenic
912582294 1:110731396-110731418 TGTAACAAAGTACCACAAACTGG - Intergenic
915099348 1:153487621-153487643 AGAGAAAAAGAAACAGAAACAGG - Intergenic
915882784 1:159689651-159689673 GGTGAAAAAAAAAAAAAAACAGG - Intergenic
916732516 1:167579392-167579414 TGTAACAAAGCACCACAAACTGG - Intergenic
916965092 1:169930739-169930761 AATGACAAAAAAACACCAACCGG - Intronic
917294861 1:173507887-173507909 TGTAACAAAGTACCACAAACTGG - Intronic
918454657 1:184696427-184696449 GGTTAAAAAAAAACAAAAACAGG - Intronic
919065714 1:192690648-192690670 AGTGAAAAAGAAACAAATACAGG + Intergenic
919084218 1:192901874-192901896 TGTGACAAAGTAAAACAAACTGG - Intergenic
919156122 1:193767818-193767840 GGTAACAAAGTACCACAAACTGG - Intergenic
919319111 1:196011898-196011920 TGTAACAAAGTATCACAAACTGG + Intergenic
919416954 1:197322560-197322582 GTTAACAACGAAAAACAAACAGG - Intronic
919474682 1:198019195-198019217 TGAGACAAAGAACCACAAAAGGG - Intergenic
919929539 1:202212412-202212434 CGTGACAAAGTACCGCAAACTGG + Intronic
920182740 1:204142626-204142648 CTGGACAGAGAAACACAAACAGG - Intronic
920781919 1:209001775-209001797 GATGACTTAGAAAAACAAACTGG - Intergenic
921227648 1:213036241-213036263 GGTGACAAAAAAAAAAAAAGAGG - Intergenic
921716460 1:218422043-218422065 AGTAACAAAGTACCACAAACTGG - Intronic
921829809 1:219714693-219714715 TTTGACTAAGAAACAAAAACTGG - Intronic
922023298 1:221726183-221726205 GGGGAAAAATAAACTCAAACTGG + Intronic
922199141 1:223386768-223386790 ACTGACACAGAAACACAAAACGG - Intergenic
922234788 1:223714139-223714161 GGTGACAGAGAAAAACAAGGTGG - Intronic
922918118 1:229275468-229275490 CATCACAAAGAACCACAAACTGG - Intronic
922944390 1:229499198-229499220 GTTCACAAAGAAACAAAATCTGG - Intronic
923952923 1:238980310-238980332 GGTAACAAAGTACCACAGACTGG - Intergenic
924421500 1:243914234-243914256 AGTAACAAAGTACCACAAACTGG - Intergenic
924493316 1:244561469-244561491 CGTAACAAAGTACCACAAACTGG + Intronic
1062834763 10:628494-628516 GGTGGGACAGAGACACAAACAGG + Intronic
1063003636 10:1947608-1947630 TGTAACAAAGTATCACAAACTGG + Intergenic
1063116078 10:3072936-3072958 TGTGGAAAAGAAACACAAAACGG - Intronic
1063261174 10:4391324-4391346 TGTGACCCAGAAACAAAAACAGG + Intergenic
1063532844 10:6852397-6852419 GGTGAGACAGAAAAACATACAGG + Intergenic
1063771604 10:9209424-9209446 GGTGTCCAAGCAAAACAAACGGG - Intergenic
1064980124 10:21158087-21158109 TGTGACAAAGTACCATAAACGGG - Intronic
1065159000 10:22899757-22899779 TGTGACAAAGTAGCATAAACTGG - Intergenic
1065811963 10:29450699-29450721 TGTGACAAAGTACCACAAACTGG + Intergenic
1065959816 10:30725458-30725480 TATGACAAAGTACCACAAACTGG - Intergenic
1066105759 10:32155380-32155402 GGTAACACAGAAACACCAATAGG - Intergenic
1066448493 10:35506539-35506561 GGTGAAGAAGAAACAGAAAGAGG - Intronic
1066589742 10:36981540-36981562 GGTAACAAAGTACCACAAACTGG - Intergenic
1067914094 10:50377664-50377686 TGTAACAAATAACCACAAACTGG + Intronic
1068550763 10:58405299-58405321 GGTGACAAAGAAAAATTAATTGG - Intergenic
1068654850 10:59564138-59564160 GGTGACAAACAAACCCAGATTGG + Intergenic
1069378689 10:67820062-67820084 CCTGACACAGAAGCACAAACTGG + Intronic
1071093466 10:81946947-81946969 TGTGACAAAGCACCACAAACTGG + Intronic
1071177184 10:82940213-82940235 TGTAACAAAGCACCACAAACTGG + Intronic
1071418082 10:85459717-85459739 GGTGACAAAGAAAAAGAATGAGG - Intergenic
1071457642 10:85863118-85863140 TGTAACAAAAAAACACAGACTGG + Intronic
1071974784 10:90944452-90944474 CGTAACAAAGTACCACAAACAGG + Intergenic
1072601687 10:96937146-96937168 GGAGACACAGACACACACACAGG + Intronic
1072798068 10:98371896-98371918 TATGACAAAGAACCACAAATTGG + Intergenic
1073786027 10:106890576-106890598 GAAGACAAAGGAACAGAAACTGG + Intronic
1074100608 10:110351988-110352010 TGTGACAGATAACCACAAACTGG - Intergenic
1074127538 10:110541345-110541367 GGTGACAGAGATAAATAAACAGG - Intergenic
1074259442 10:111837008-111837030 GGTCACAAAGCAACACAATTTGG + Intergenic
1074962018 10:118455472-118455494 GGTCACAAAGAAAGAAACACAGG - Intergenic
1078990958 11:16645851-16645873 TGTAACAAAGTACCACAAACTGG - Intronic
1079308422 11:19344669-19344691 CGTGTCCAAGAATCACAAACGGG + Intergenic
1079925479 11:26487411-26487433 GCTGATAAAGGCACACAAACTGG - Intronic
1080055516 11:27902545-27902567 GGTGACAAAGGAACAGATGCAGG - Intergenic
1080211135 11:29786985-29787007 GGTGACAGAGAAAAAAATACAGG - Intergenic
1080353710 11:31416343-31416365 GGTTAAAAAGATACACCAACGGG - Intronic
1081199696 11:40201294-40201316 GGTGACTAAGACAAAAAAACAGG - Intronic
1081530433 11:43954906-43954928 GGTGACAAAGAAAAGGAAAGAGG + Intergenic
1081562519 11:44230800-44230822 GTTAACAAAGAACCACAAATTGG - Intronic
1082868310 11:57919840-57919862 TATAACAAAGTAACACAAACTGG - Intergenic
1083473848 11:62902845-62902867 CGTAACAAAGTACCACAAACTGG - Intergenic
1084073705 11:66755630-66755652 TGTAACAAAGTACCACAAACTGG + Intronic
1084311309 11:68317709-68317731 GGTGACAAACTAGGACAAACTGG - Intronic
1084315983 11:68346181-68346203 GGCCACAAATAAAGACAAACGGG - Intronic
1084673740 11:70622442-70622464 TGTTACAAAGCAACACAAACTGG + Intronic
1084852619 11:71955053-71955075 GGAAACAAATAAACATAAACAGG + Intronic
1085858125 11:80198768-80198790 TGTGACAAAGAGACAGAAAGTGG - Intergenic
1086127038 11:83359501-83359523 GCTGACACTGAAACACAAAATGG - Intergenic
1088001110 11:104881574-104881596 GGAGACAAAGAAAGACAGAAAGG + Intergenic
1089011796 11:115137463-115137485 GGTGACACAGGACCACCAACTGG + Intergenic
1089187213 11:116627426-116627448 TGTAACAAAGTACCACAAACTGG + Intergenic
1089496547 11:118911089-118911111 AGTCACAAAGAAACACGCACAGG + Intronic
1092770525 12:11892407-11892429 GGTGAAAAAGAGCCACAAATGGG - Exonic
1093338182 12:17935885-17935907 TGTAACAAAGTAGCACAAACTGG + Intergenic
1093507050 12:19879789-19879811 GGTGAAAAAGAAAAAGAAAAAGG - Intergenic
1093626652 12:21357285-21357307 GGTCACAGAGACACACACACAGG + Intronic
1093974874 12:25410588-25410610 TGTAACAAAGTACCACAAACTGG - Intronic
1094277712 12:28697117-28697139 GGTTACACACAAACACAAAGAGG - Intergenic
1094318684 12:29160580-29160602 TGTAACAAAGTACCACAAACTGG + Intronic
1095969141 12:47889688-47889710 GGAGACCAAGAAATAGAAACTGG + Intronic
1096302725 12:50445924-50445946 GGTGAAAAAGAATCAAAAAAAGG - Intronic
1096323307 12:50634707-50634729 GGTGAATAAGACACACAAACAGG - Intronic
1096376555 12:51116472-51116494 GCTGACAAAGAAAAACTAGCAGG + Intronic
1096644432 12:53022872-53022894 GTTTATAAAGAAACCCAAACTGG + Intronic
1097440961 12:59608137-59608159 AGTGACAAAGAAACAGAGAGAGG - Intronic
1097618670 12:61913974-61913996 TGTGATAAAGTAACAGAAACAGG + Intronic
1098147820 12:67515892-67515914 AGTGAAAAACAAACACTAACAGG + Intergenic
1098604085 12:72369181-72369203 GGTCCCATAGAAACACCAACAGG + Intronic
1100695760 12:97091070-97091092 TGTGAAAAAGAAACTGAAACAGG + Intergenic
1100894263 12:99161573-99161595 GGTGACAAACAATCAAAAAGTGG + Intronic
1101039196 12:100736985-100737007 TGTGACAAAGTACCACAAACTGG - Intronic
1101215373 12:102576398-102576420 TCTGACAAAGAAGCACAGACAGG - Intergenic
1101395107 12:104340404-104340426 TGTAACAAAGTACCACAAACTGG + Intronic
1101469016 12:104977704-104977726 GGTGACCAAGAACCAGAAGCTGG - Intergenic
1101725398 12:107384442-107384464 GGGAACAAAGAAACCCAACCAGG - Intronic
1101795868 12:107973128-107973150 AGTGACAAAGTGCCACAAACTGG + Intergenic
1101953442 12:109193969-109193991 GGTAACAAGGTACCACAAACTGG + Intronic
1103033912 12:117641014-117641036 TGTAACAAAGTACCACAAACTGG + Intronic
1103799556 12:123528724-123528746 TGTAACAAATCAACACAAACTGG - Intronic
1103929059 12:124439586-124439608 GGTGAGAAAGAGACAGAGACTGG + Intronic
1104111364 12:125707847-125707869 GATGAATAAGAAACACATACAGG + Intergenic
1104181379 12:126385156-126385178 GGTGACAAAGAAAAGGAAAGAGG - Intergenic
1104467669 12:129003949-129003971 GGTAAGTTAGAAACACAAACTGG - Intergenic
1104765281 12:131326144-131326166 GATGAGAAAGAAACACCAAGGGG - Intergenic
1105047804 12:133020665-133020687 CGTAACAAAGAACCACAAACTGG + Exonic
1105249963 13:18689562-18689584 TGTAACAAAGTACCACAAACCGG - Intergenic
1105508679 13:21033235-21033257 GTTGAGAAAGAAAGAGAAACAGG + Intronic
1106329925 13:28730624-28730646 GGTAACAAAGTACCACAAGCTGG + Intergenic
1106333769 13:28764325-28764347 CATGACAAAGTAACACAGACTGG + Intergenic
1106529721 13:30578305-30578327 GGGAACAAAGACACACCAACAGG - Intronic
1106907077 13:34420420-34420442 TGTCACAAAGCACCACAAACTGG + Intergenic
1107271998 13:38630706-38630728 GGTGACAAGGAAAGGCAGACTGG - Intergenic
1107617878 13:42190504-42190526 GGTGCCAAAGAATCAATAACTGG + Exonic
1108505349 13:51107933-51107955 TGTAACAAAGCACCACAAACTGG + Intergenic
1108716267 13:53081103-53081125 TGTAACAAAGCACCACAAACAGG - Intergenic
1108851098 13:54730253-54730275 GATGAGAAAGAAACAGAAAAAGG - Intergenic
1108935914 13:55879574-55879596 GGTGACACAGAAAGAAAAACAGG - Intergenic
1109682631 13:65772556-65772578 GGTGACAAAGAAACATATTTGGG - Intergenic
1110098385 13:71561650-71561672 TGTAACAAAGAACCAGAAACTGG - Intronic
1110231416 13:73171303-73171325 AGTTACTAAGAAACCCAAACAGG + Intergenic
1110399391 13:75072055-75072077 GCAGACAAAGAAACACAAGGAGG - Intergenic
1110523109 13:76504298-76504320 TGTTACAAAGAAACAGAAAATGG - Intergenic
1110986916 13:81982797-81982819 GGACACAAACAAACACAAAGAGG - Intergenic
1111099170 13:83558906-83558928 TTTGACAAAGTACCACAAACTGG - Intergenic
1111147138 13:84197173-84197195 AGTGACAAAAAAACACAAGAAGG + Intergenic
1111596243 13:90415034-90415056 GGTGAGAGAGAAACCCACACTGG + Intergenic
1111622946 13:90747547-90747569 TGTAACAAAGTACCACAAACTGG + Intergenic
1111734222 13:92116446-92116468 CATGACAAAGAATCACAAACCGG - Intronic
1111841605 13:93456567-93456589 AGTTACAAAGAACCGCAAACTGG + Intronic
1111998409 13:95187904-95187926 GGTGAGACAGATATACAAACAGG - Intronic
1112344867 13:98580792-98580814 CGTAACAAAGAACCACCAACTGG + Intergenic
1112865682 13:103894054-103894076 TGTAACAAAGCACCACAAACTGG + Intergenic
1113142823 13:107174175-107174197 AGGGACAAACAAACACAAAAGGG - Intronic
1113223692 13:108134953-108134975 TGTAACAAAGTACCACAAACTGG - Intergenic
1113232721 13:108232802-108232824 GGTGAAAAAGAAATATAAAAAGG + Exonic
1113326058 13:109282310-109282332 AGAGACAAATAAACACAACCTGG - Intergenic
1113560653 13:111277819-111277841 AGTCACAACGAAACACAAACAGG - Intronic
1114282924 14:21211308-21211330 TGTGAGAAACAGACACAAACAGG + Intronic
1115448994 14:33524627-33524649 CATGACAAAGTATCACAAACTGG + Intronic
1116317495 14:43417047-43417069 GATGAGAAAGAATCACAAAAAGG - Intergenic
1117025277 14:51613254-51613276 GGTGACAAAGAAACACAAACAGG + Intronic
1117472421 14:56059394-56059416 GGTGACAAAGAAAAAGAAACTGG + Intergenic
1117595476 14:57323062-57323084 GGTGAAAGAGAAACAGTAACAGG - Intergenic
1119456492 14:74760451-74760473 TGTAACAAAGCACCACAAACTGG + Intergenic
1119640474 14:76310777-76310799 AGTCACAAAGAGACACAGACAGG + Intronic
1119934849 14:78582584-78582606 GGTGAGACTGAAACACAGACGGG - Intronic
1119993338 14:79224956-79224978 TGTAACAAAGAACCACAAACTGG - Intronic
1121800383 14:96769469-96769491 TGTCACAAAGCACCACAAACTGG + Intergenic
1121814233 14:96916726-96916748 CGTAACAAAAAAACACAAACTGG - Intronic
1122188706 14:100022685-100022707 GGTGCCAAGGAAACAAAAACAGG - Intronic
1202834529 14_GL000009v2_random:67938-67960 GAGAACAACGAAACACAAACGGG - Intergenic
1124668448 15:31615635-31615657 GTTCACAAAGAAACAAAAAGTGG - Intronic
1124711281 15:32014346-32014368 GTTCACAGAGAAACACACACTGG + Intergenic
1125518736 15:40336846-40336868 GGTGACAAAGGATCCAAAACAGG + Intronic
1125711485 15:41790636-41790658 TGTGACAAACAAACAAAAAAAGG - Intronic
1125972636 15:43924267-43924289 GGTGGCAAAGAAGGTCAAACAGG + Exonic
1127152337 15:56089361-56089383 GATGGAACAGAAACACAAACAGG + Exonic
1127287294 15:57543006-57543028 TGTAACAAAGTAACACAACCTGG + Intronic
1127592981 15:60445791-60445813 GCTGAAAAAGAAATACAAAGTGG + Intronic
1127616356 15:60690031-60690053 GGTAACAAAGTGCCACAAACTGG - Intronic
1127733685 15:61822378-61822400 GGGGAAAAAAAAACACAAAAAGG - Intergenic
1128364389 15:66987040-66987062 GGTCCCAAAGAAAAACAAGCTGG + Intergenic
1128498144 15:68209931-68209953 GGTGGGACAGAAACAGAAACAGG + Intronic
1130781702 15:87046711-87046733 GGTGACAATGTAACATAATCTGG - Intergenic
1131040199 15:89257563-89257585 CTGGACACAGAAACACAAACAGG - Intronic
1131513922 15:93065275-93065297 GGGGGCAAAGAAAAACAACCAGG + Intronic
1131887159 15:96928389-96928411 GGTAGAAAAGAATCACAAACTGG + Intergenic
1131958758 15:97765974-97765996 CGTTACAAAGTACCACAAACTGG - Intergenic
1132299879 15:100768819-100768841 GGACACACAGACACACAAACAGG - Intergenic
1133133576 16:3693591-3693613 TGTGTAAAAGAAACACAAAAAGG + Intronic
1133618149 16:7499073-7499095 GAAAACAAAGAACCACAAACTGG + Intronic
1133741920 16:8658357-8658379 GGTAACAAATGACCACAAACTGG - Intergenic
1133856526 16:9554658-9554680 CGTGACAAAGAACCACAGATTGG + Intergenic
1135110474 16:19687028-19687050 GGAGACACAGACACACAAACAGG - Intronic
1135167710 16:20155497-20155519 TGTAACAAACAACCACAAACTGG + Intergenic
1135209268 16:20510271-20510293 TGTGACAAAGAAAATAAAACAGG - Intergenic
1137277731 16:46947768-46947790 TGTGAAAAAAAAACACAAAAAGG - Intergenic
1139418450 16:66832865-66832887 CGTAACAAAGAACCACAAACTGG + Intronic
1140260053 16:73370491-73370513 GGTGGCACATAAACACAAATAGG + Intergenic
1140292827 16:73678954-73678976 GATGACCAAGAATCACCAACAGG + Intergenic
1141485854 16:84339840-84339862 GGAGGCAAAGAAACACAGAAGGG + Intergenic
1141616822 16:85214608-85214630 TGTGACAAAGAACCACCATCTGG - Intergenic
1141650688 16:85391368-85391390 CGTAACAAAGTACCACAAACTGG + Intergenic
1144015837 17:11194823-11194845 ACAGACAAAGAAACACAATCTGG - Intergenic
1144290776 17:13824191-13824213 TGCAACAAAGAACCACAAACTGG + Intergenic
1144830296 17:18127358-18127380 GCTGCCACAGAAACACAGACAGG - Intronic
1146024691 17:29309367-29309389 GGTGTGAAAGAAACAAATACAGG - Intergenic
1146130771 17:30273035-30273057 AGTAACAAAGAAACACAAGGTGG + Intronic
1146312471 17:31779799-31779821 GGTAACAAACTATCACAAACTGG - Intergenic
1147194285 17:38755001-38755023 GGTGACAAAAAAAAAAAAAAGGG - Intronic
1148183869 17:45627240-45627262 GGACACAAAGAAATACACACAGG - Intergenic
1148264866 17:46217582-46217604 GGACACAAAGAAATACACACAGG + Intronic
1148390035 17:47265304-47265326 TGTAACAAAGCACCACAAACTGG + Intronic
1148629129 17:49093055-49093077 GGAGACAAAGAAAAACAAGGAGG - Intergenic
1149207134 17:54261299-54261321 TCTGACAAAGTACCACAAACTGG - Intergenic
1149696964 17:58623701-58623723 ACTGAAAAAGAAACACAAATAGG + Intronic
1150252862 17:63718309-63718331 GGTGAGAGAGATACACAACCAGG + Intronic
1150333634 17:64314167-64314189 GGTGAGAAGCACACACAAACTGG + Intergenic
1150460453 17:65345970-65345992 GGTGAGAGAGAGACACAGACTGG + Intergenic
1150506560 17:65704321-65704343 TGTAACAAAGAACCAAAAACTGG - Intronic
1150834025 17:68548568-68548590 TGTGACACAGAGACACAAAGTGG + Intronic
1151055236 17:71023084-71023106 GGTGATAAAGAAATAAAAATAGG - Intergenic
1152009354 17:77701602-77701624 TGTAACAAAGCATCACAAACTGG + Intergenic
1152390353 17:80000584-80000606 TGTGACAAAGGACCACAAACCGG - Intronic
1152478028 17:80531086-80531108 TGTAACAAAGTACCACAAACTGG - Intergenic
1152500681 17:80706722-80706744 GGTCACAGGGAAAAACAAACAGG - Intronic
1152623200 17:81376194-81376216 TGTGACCAAGGGACACAAACAGG + Intergenic
1153035503 18:758508-758530 GGGGAAAAAGAAACCCAAAATGG - Intronic
1153184039 18:2467319-2467341 GGTAACAAAGTATCACAGACTGG - Intergenic
1153578284 18:6544928-6544950 GATTACAAAGAAAGAAAAACAGG - Intronic
1154438863 18:14369334-14369356 TGTAACAAAGTACCACAAACTGG + Intergenic
1154518794 18:15203591-15203613 CATAACAAAGTAACACAAACTGG + Intergenic
1155506995 18:26543643-26543665 GAAGACAATAAAACACAAACAGG + Intronic
1156260287 18:35439829-35439851 TGTAACAAAGCACCACAAACTGG - Intergenic
1156371050 18:36471422-36471444 GGTGACCAAGGAAAACAAAGGGG - Intronic
1156437608 18:37149787-37149809 AGTGAAAAAGAAAACCAAACAGG + Intronic
1157537166 18:48468388-48468410 TGTAACAAAGCACCACAAACTGG - Intergenic
1157586060 18:48802022-48802044 GGTGACAGAGTGACGCAAACAGG - Intronic
1157816122 18:50730486-50730508 GGTGACTAGGAGAAACAAACTGG - Exonic
1157883198 18:51341626-51341648 TGTGACAAAGGACCACAGACTGG - Intergenic
1158259726 18:55593211-55593233 GGTCACAAAGAGACAGAAAAGGG - Intronic
1158415683 18:57247923-57247945 TGTAACAAAGTACCACAAACTGG + Intergenic
1158625713 18:59069945-59069967 TGTGACAAAGTACCAAAAACTGG - Intergenic
1158771761 18:60526400-60526422 GGGCACAAATAAACACAGACTGG + Intergenic
1158827114 18:61235142-61235164 CGTAACAAAGTACCACAAACTGG + Intergenic
1160287604 18:77559476-77559498 CTTAACAAAGAAACACAAGCTGG + Intergenic
1160853306 19:1205293-1205315 GGTCAAAAAGTAACACAAAGTGG - Intronic
1161095851 19:2390159-2390181 GGTGACAGAGAAACAGAGACAGG + Intronic
1161228596 19:3160647-3160669 CGTAACAAAGTACCACAAACTGG + Intronic
1161242055 19:3228194-3228216 AGAGACAGAGAAACACAGACAGG + Intronic
1161806586 19:6447148-6447170 TGTAACAAAGTATCACAAACTGG - Intronic
1162230962 19:9265935-9265957 GGTGACAAATGGCCACAAACTGG + Intergenic
1162577661 19:11508105-11508127 GGGGACAGAGAAACAGAAAGGGG + Intronic
1164834379 19:31348569-31348591 GGGGGCGAGGAAACACAAACAGG + Intronic
1166306067 19:41937723-41937745 GGAGACACAGAAACTCAGACGGG + Intergenic
1166949756 19:46419000-46419022 CGTGACAAACAAAAACAGACTGG - Intergenic
1167359158 19:49020673-49020695 GGGTACAAAGAAACACAAGGAGG + Intergenic
1167912546 19:52715966-52715988 TGTGACAAAAACACACGAACGGG + Intronic
1167927518 19:52833680-52833702 TGTGACAAAAACACACAGACAGG + Intronic
1168428228 19:56256899-56256921 GGTGAAAAAAAAAAGCAAACAGG + Intronic
1202638165 1_KI270706v1_random:59754-59776 GAGAACAACGAAACACAAACGGG + Intergenic
925073947 2:995861-995883 TGTGGAAAAGAAACACAATCAGG + Intronic
925112871 2:1351664-1351686 GGTGACAGAGAAACAAACCCAGG - Intronic
925643013 2:6005468-6005490 TGTAACAAAAAACCACAAACTGG + Intergenic
926511837 2:13791342-13791364 CGTGACAAAGTACCACAGACTGG + Intergenic
926613015 2:14966233-14966255 CGTTACAAAGTACCACAAACTGG - Intergenic
927922743 2:26986012-26986034 TGTGACAAATGACCACAAACTGG - Intronic
928191107 2:29169155-29169177 TGTGACAAAGTACCACAGACTGG + Intronic
928429449 2:31205606-31205628 GGTGAGAAAGAGACAGAAGCAGG + Intronic
928653231 2:33423464-33423486 GGGGACAAATGACCACAAACTGG + Intergenic
929051570 2:37841398-37841420 GGTGAAAAAAAAAAAAAAACTGG - Intergenic
930647631 2:53928856-53928878 AGTGAAAAAAGAACACAAACTGG + Intronic
931195419 2:60048054-60048076 GCTCACAAAGAAACACCACCAGG + Intergenic
931259450 2:60604523-60604545 TGTGACAAAGTACCATAAACTGG - Intergenic
931424024 2:62154490-62154512 TGTAACAAAACAACACAAACTGG + Intergenic
931835274 2:66092468-66092490 GGTCACAAAGAAAAGGAAACAGG + Intergenic
932373058 2:71208983-71209005 TGTGACAAATTACCACAAACTGG - Intronic
935285541 2:101560962-101560984 TGTAACAAAGCATCACAAACTGG - Intergenic
936529112 2:113262923-113262945 AGTGACAAAGTACTACAAACTGG - Intronic
936673031 2:114681767-114681789 GATGACAAAGAAATAAAAATAGG - Intronic
936786878 2:116104127-116104149 GGTGACAAAGAAAAGAAAAACGG - Intergenic
936968187 2:118147761-118147783 TGTAACAAACAACCACAAACTGG + Intergenic
937587745 2:123574663-123574685 GTAGAAAAAGAAACATAAACTGG + Intergenic
938630358 2:133160091-133160113 TGTAACAAAGTAACACAAACTGG + Intronic
938744086 2:134260545-134260567 TGTGAAAAAGGAACAAAAACAGG + Intronic
938878079 2:135554870-135554892 TGTGACAAAGTATGACAAACTGG - Intronic
938993310 2:136651811-136651833 GGTTCCAGAGATACACAAACAGG - Intergenic
939035577 2:137127110-137127132 TGTGACACAGAATCACAAAGCGG + Intronic
939130427 2:138229315-138229337 TGTTACAAAGAAACATAAATTGG + Intergenic
939556199 2:143676786-143676808 TGTGACACAGAGACACAAAATGG + Intronic
939742156 2:145921876-145921898 GGTAACAAAGGACCACAGACTGG - Intergenic
939836645 2:147137305-147137327 ATTAACAAAGAACCACAAACTGG + Intergenic
941077423 2:161021714-161021736 TGTGACACAGAGACACAAAGTGG - Intergenic
941307105 2:163883873-163883895 GGAGAGAAAGAAAGACAAATAGG - Intergenic
941522502 2:166563953-166563975 GGTAACAAATTACCACAAACGGG - Intergenic
941645114 2:168031811-168031833 CTTAACAAAGAACCACAAACTGG - Intronic
942112427 2:172695446-172695468 GGGGAAAAAGAAACTCAAGCAGG + Intergenic
942666597 2:178325961-178325983 ACTGACACAGAAACACAACCAGG - Intronic
942933150 2:181520726-181520748 TGTAAAAAAGATACACAAACGGG - Intronic
943533971 2:189123560-189123582 GATAACAAAGTACCACAAACTGG - Intronic
945091950 2:206183946-206183968 TGTAACAAAGCAACAGAAACTGG + Intronic
945270230 2:207930877-207930899 GGCGGGAAAGAAAAACAAACGGG + Intronic
945842874 2:214908943-214908965 GGTGTCAAAGAAAAAGATACAGG - Intergenic
945876705 2:215285375-215285397 TGTGACAAAATATCACAAACTGG + Intergenic
946013069 2:216582158-216582180 TATAACAAAGAAACACAGACTGG + Intergenic
946039480 2:216771505-216771527 GGAGACAAAGCAAGACAGACAGG - Intergenic
946460828 2:219867104-219867126 TGTAACAAAGTACCACAAACTGG + Intergenic
946701482 2:222418711-222418733 TATGACAAAGTACCACAAACTGG + Intergenic
947626410 2:231621798-231621820 GATGAAACAGAAACAGAAACAGG - Intergenic
947709434 2:232303277-232303299 GGAAACAGAGGAACACAAACAGG - Intronic
947765928 2:232637309-232637331 GAAGACACAGAAACACACACAGG - Intronic
948147906 2:235722219-235722241 GGTAACAAAGTACCACAAACTGG + Intronic
1168886526 20:1263259-1263281 AGTGACAAAAAAACAACAACAGG + Intronic
1169895772 20:10503626-10503648 TGTAACAAACAACCACAAACTGG + Intronic
1169907342 20:10617186-10617208 GCAGATAAACAAACACAAACTGG - Intronic
1169971552 20:11274263-11274285 AGTGACAAAGAAAATAAAACCGG + Intergenic
1170636269 20:18107367-18107389 AGTAACAAACAAACAAAAACTGG - Intergenic
1171884744 20:30643817-30643839 GAGAACAACGAAACACAAACGGG + Intergenic
1173636908 20:44567664-44567686 GGTGCACAAGAAACACAAGCTGG - Intronic
1174242485 20:49148797-49148819 GGAGACTCAGAAACACCAACAGG + Intronic
1174279927 20:49431979-49432001 GGAGACTAAGACACACAAAAGGG + Intronic
1174958417 20:55127484-55127506 TGTAACAAAGTATCACAAACTGG - Intergenic
1175001640 20:55635517-55635539 GGCAACAAACAAACAGAAACTGG - Intergenic
1175749934 20:61489036-61489058 GATGACTCTGAAACACAAACAGG + Intronic
1176456819 21:6920098-6920120 TGTAACAAAGTACCACAAACTGG - Intergenic
1176834992 21:13785158-13785180 TGTAACAAAGTACCACAAACTGG - Intergenic
1177003837 21:15646405-15646427 AATGACAAAGAAACACAATCTGG + Intergenic
1177083479 21:16672169-16672191 GGGGACAGAGAAAAACAACCTGG - Intergenic
1177302813 21:19272000-19272022 GGTAACAAAATACCACAAACTGG + Intergenic
1177924432 21:27196473-27196495 CATAACAAAGAACCACAAACAGG + Intergenic
1178546349 21:33495986-33496008 TGTGACAAAGCACCACAGACTGG - Intergenic
1178634970 21:34294441-34294463 GGTAAGGAACAAACACAAACTGG + Intergenic
1178757267 21:35363620-35363642 TGTAACAAAGCACCACAAACTGG - Intronic
1179034208 21:37745887-37745909 CGTGACAAAGTACCACCAACTGG + Intronic
1179047695 21:37861196-37861218 TGTAACAAAGTACCACAAACTGG + Intronic
1179469146 21:41598882-41598904 GGTGACAAAGGACCACAAAACGG - Intergenic
1180363802 22:11922125-11922147 GAGAACAATGAAACACAAACGGG - Intergenic
1181692659 22:24573255-24573277 TGTGACAAAAACACAGAAACTGG + Intronic
1181925382 22:26354494-26354516 CTTGACAAAGGACCACAAACCGG - Intronic
1182192234 22:28473987-28474009 TGTAACAAAGTACCACAAACTGG - Intronic
1182390161 22:29987205-29987227 CTGGACAAAGAAACAGAAACTGG - Intronic
1182606025 22:31504589-31504611 TGTAACAAAGTACCACAAACCGG + Intronic
1182626425 22:31650060-31650082 TGTAACAAAGCAACACAAACTGG - Intronic
1183013993 22:34971023-34971045 TATAACAAAGTAACACAAACTGG - Intergenic
1185032181 22:48449896-48449918 GGGGACAGAGACACTCAAACAGG + Intergenic
1185226926 22:49658462-49658484 CGTGACAAAGGACCACAAACTGG + Intergenic
1185418905 22:50724353-50724375 TCTGAGAAAGAAAAACAAACAGG - Intergenic
949285054 3:2392819-2392841 TGTAACAAAGTACCACAAACTGG + Intronic
950307499 3:11927826-11927848 GGTGAGAAAGGAACACAGAGAGG + Intergenic
951056956 3:18158379-18158401 GGTGACAATAACACACAAAAGGG + Intronic
952347709 3:32503706-32503728 GGTGACCAAGAAAGAGAAAAAGG - Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953338810 3:42116873-42116895 GGTGACAAAGAACAAGAAAAGGG - Intronic
955064976 3:55526297-55526319 TGTAACAAAGTACCACAAACTGG - Intronic
955476463 3:59341322-59341344 TGTGACACTCAAACACAAACAGG - Intergenic
955497121 3:59545304-59545326 GGTAACAAAGTGCCACAAACTGG - Intergenic
955511205 3:59682123-59682145 GGTGAAAAAAAAAAAAAAACAGG - Intergenic
955796122 3:62639051-62639073 GCTCACAAACACACACAAACTGG + Intronic
956282606 3:67573775-67573797 GGTGAAAAAGAAAAAAAAAGGGG - Intronic
956491579 3:69777992-69778014 GGTGACAAAGAAAACCAATAAGG + Intronic
956717369 3:72090140-72090162 TGTGACAAAGGACCACAAACTGG + Intergenic
956752387 3:72353648-72353670 CGTAACAAAGTACCACAAACTGG - Intergenic
956821511 3:72958418-72958440 GGTGACATACAAACAAACACAGG - Intronic
956861050 3:73324070-73324092 GGTGATAAAAAGACACAGACAGG - Intergenic
956942205 3:74176206-74176228 TGTGACACAGAAACACGAAGTGG + Intergenic
957469675 3:80642307-80642329 TGGGACAAAGAAACACACAGAGG - Intergenic
957671188 3:83304560-83304582 CATAACAAAGAACCACAAACTGG - Intergenic
958738458 3:98038525-98038547 GCTGCCAAAGAAATAAAAACTGG - Intergenic
960235479 3:115277158-115277180 TGTAACAAAGTACCACAAACTGG + Intergenic
960749185 3:120927424-120927446 GATGACAAAGAGAAACAAAGAGG - Intronic
960851559 3:122060039-122060061 GGTAACAAAGTACCACAAACTGG - Intronic
960852200 3:122067353-122067375 GGTGACAAAGACTCTAAAACTGG + Intronic
962094387 3:132278514-132278536 GCTAACAAAGTAACACAAACCGG - Intronic
962195458 3:133358869-133358891 AGGGAGAAAGCAACACAAACAGG + Intronic
962497725 3:135959314-135959336 ATAGACAAAGAAACAAAAACTGG - Intergenic
963503389 3:146156748-146156770 TATGAGAAAGAAACAGAAACTGG - Intronic
963669052 3:148229418-148229440 TGTAACAAAGTACCACAAACTGG + Intergenic
965290947 3:166879583-166879605 GGTAACAAAGTACCACAATCTGG + Intergenic
965805167 3:172534474-172534496 AGTAACAAAGATACACATACTGG - Intergenic
965898731 3:173612726-173612748 TGTAACAAAGTACCACAAACTGG + Intronic
965903184 3:173669288-173669310 TGTAACAAAGTACCACAAACTGG + Intronic
966149334 3:176849358-176849380 AGGGACAAAGATCCACAAACTGG - Intergenic
967494896 3:190131810-190131832 GGTAAAAAAGAAAAACAAAATGG - Intergenic
968063843 3:195747383-195747405 GGTGACCAAGAGAGACAGACAGG + Intronic
968802079 4:2749725-2749747 TGTAACAAAGTAACACAAACTGG - Intronic
969055296 4:4397793-4397815 GGGAACAGAGAAATACAAACAGG - Intronic
969206683 4:5652453-5652475 TGTAACAAAGTAACACAAAGTGG + Intronic
969314680 4:6374649-6374671 GGTGACAGAGGAACACAGAGAGG - Intronic
969967332 4:11010827-11010849 TGTAACAAAGTATCACAAACTGG - Intergenic
969973003 4:11067224-11067246 CATGACAAAGTACCACAAACTGG + Intergenic
970638868 4:18041158-18041180 CATAACAAAGAATCACAAACTGG + Intergenic
972722745 4:41716842-41716864 CATGACAAAGAACTACAAACTGG - Intergenic
973321392 4:48813661-48813683 GGAAACAAACAAACAAAAACTGG + Intronic
974002982 4:56529889-56529911 AGTCACAAAGAAACACTGACTGG - Intergenic
974308305 4:60171657-60171679 CGTTACAAAGTATCACAAACTGG + Intergenic
974419811 4:61658886-61658908 TGTAACAAAGTACCACAAACAGG + Intronic
974546535 4:63315735-63315757 GGTAACAAAGCACCACAAACTGG + Intergenic
976956580 4:90908916-90908938 CGTAACAAAGTACCACAAACTGG + Intronic
978137315 4:105278009-105278031 AGTTAAAAAGAAACAAAAACAGG + Exonic
978861550 4:113455988-113456010 GGTGAAAAACACACAAAAACGGG + Intronic
978999843 4:115202864-115202886 GGTAACAAAAAAACACGAAGGGG - Intergenic
979312404 4:119219179-119219201 TGTAACAAAGAACCACAAACTGG + Intronic
980039367 4:127921675-127921697 GATGACAATGAAAGACCAACTGG - Exonic
980493460 4:133560526-133560548 TGTCACACACAAACACAAACAGG - Intergenic
980500784 4:133650077-133650099 GATCACAGAGACACACAAACAGG - Intergenic
980593195 4:134918199-134918221 AGTAACAAAGTACCACAAACTGG - Intergenic
980845957 4:138325380-138325402 TGTAACAAAGTAGCACAAACTGG + Intergenic
981189827 4:141849306-141849328 GGTGACTAAGAAAAATAAATGGG + Intergenic
982363831 4:154553165-154553187 TGTAACAAAGTACCACAAACTGG + Intergenic
982625778 4:157764544-157764566 GGAGAGAGAGAAAAACAAACAGG - Intergenic
983361070 4:166724011-166724033 GGTGAAAAAGAAAAAAAAAAAGG + Intergenic
983870935 4:172824615-172824637 AGTGAAAAAGAAACAAAATCTGG + Intronic
984732172 4:183078315-183078337 GAGGAGAAAGAAACACACACAGG + Intergenic
985314487 4:188641543-188641565 TGTGAAAAAGAAACAAAAAGAGG - Intergenic
985433811 4:189907958-189907980 GGTGACAAGGAGACACAATAGGG - Intergenic
985529465 5:425185-425207 GGTGGGAAAGACACAGAAACAGG - Intronic
985609307 5:878026-878048 AGTGACAAAGCACCACAGACTGG - Intronic
985771701 5:1815848-1815870 CAGGACAAAGAAACAAAAACCGG + Exonic
986013342 5:3736853-3736875 AGTGAAAAAGAAACACAAGTGGG + Intergenic
986745237 5:10737919-10737941 GGACACAAAGACACACAAAGAGG + Intronic
986828421 5:11547474-11547496 AGTGAAAAAAAGACACAAACTGG + Intronic
986990693 5:13549531-13549553 TGTAACAAAGTACCACAAACTGG + Intergenic
987127315 5:14826421-14826443 GTTGATGAAGAAGCACAAACAGG - Intronic
987263797 5:16230045-16230067 CGTAACAAAGCACCACAAACTGG - Intergenic
987268584 5:16281165-16281187 AGTAACAAAGAACCACAAACTGG + Intergenic
987582449 5:19811561-19811583 CGTAACAAAGTAGCACAAACTGG - Intronic
989279929 5:39629071-39629093 TGTAACAAAGTATCACAAACAGG + Intergenic
989477617 5:41892285-41892307 GGTTACAAATAAATAGAAACAGG + Intergenic
989667333 5:43870979-43871001 GGTCACAAAAAAACACAAATGGG - Intergenic
990255074 5:53959700-53959722 GGTGACAAATGATCAAAAACAGG - Intronic
990452053 5:55943767-55943789 GGGGAAAAAAAAACACAAAGCGG + Intronic
990671710 5:58137898-58137920 TGTAACAAAGTATCACAAACTGG - Intergenic
991032362 5:62095971-62095993 TGTGACAAAGTACCACAAACAGG + Intergenic
991638176 5:68727174-68727196 GTTGGGAAAGAAACACAAAAAGG + Intergenic
993106482 5:83606257-83606279 CATGACAAATAACCACAAACTGG - Intergenic
993161073 5:84292162-84292184 AGTGACAAAGTACCACAGACAGG - Intronic
993439825 5:87942395-87942417 GGTGACAAAGAAAGAGAAATTGG + Intergenic
993932566 5:93958595-93958617 AGTTACAAAGAAACACAAAGTGG - Intronic
994103089 5:95915587-95915609 GGTGACAAGGATGGACAAACTGG + Intronic
994364615 5:98898888-98898910 AGTAATAAAGAAACTCAAACAGG + Intronic
994671376 5:102765598-102765620 TGTAACAAAGTACCACAAACCGG + Intronic
994674372 5:102802665-102802687 GGTGATACAGAAATAGAAACTGG - Intronic
995012580 5:107274485-107274507 CGTGACAAAGTACCACAGACTGG - Intergenic
995568148 5:113453003-113453025 GGTGACAAAGTATCAACAACTGG + Intronic
996506572 5:124274987-124275009 GCTAACAAAGTACCACAAACAGG + Intergenic
996777170 5:127145172-127145194 GGTAACAAAGTACTACAAACTGG - Intergenic
997693688 5:135845030-135845052 TGTAACAAATAACCACAAACTGG + Intronic
998509802 5:142702135-142702157 AGTAACAAAGGAACACAACCAGG - Intergenic
998655747 5:144177382-144177404 TGTAACAAAGTACCACAAACTGG + Intronic
998723694 5:144984721-144984743 TATAACAAAGAACCACAAACTGG + Intergenic
999353353 5:150899221-150899243 TGTGACAAAGTACCACAAACTGG - Intronic
999421060 5:151444108-151444130 TCTGAAAAAGAAAAACAAACTGG - Intronic
1000298028 5:159928995-159929017 GGGGACAAGGAATCACAAATGGG - Intronic
1000580700 5:163032404-163032426 GGGGGCCAAGAAACACAACCAGG + Intergenic
1000865131 5:166504350-166504372 CGTAACAAAGTACCACAAACTGG + Intergenic
1000954675 5:167528860-167528882 AGTGACAAAGGACCACCAACAGG - Intronic
1000955955 5:167543597-167543619 TGCAACAAAGTAACACAAACTGG + Intronic
1001445952 5:171783347-171783369 CTTGACAAAGAAAAACAAAGTGG + Intergenic
1001699098 5:173693944-173693966 TGTGACAAACTACCACAAACTGG - Intergenic
1002004801 5:176223327-176223349 GGTTACAAATAAACAAAAGCAGG + Intergenic
1002221575 5:177687293-177687315 GGTTACAAATAAACAAAAGCAGG - Intergenic
1004233789 6:13855341-13855363 TGTAACAAAGTACCACAAACTGG + Intergenic
1004975982 6:20966955-20966977 TGTAACAAAGTACCACAAACTGG + Intronic
1005353317 6:24958734-24958756 TGTAACAAAGTACCACAAACTGG + Intronic
1005368549 6:25105392-25105414 TGTAACAAAGGAACATAAACTGG - Intergenic
1006604074 6:35243869-35243891 GGGGACAAAGGTATACAAACAGG - Intronic
1007356737 6:41324715-41324737 TGTGACAAATGATCACAAACTGG - Intergenic
1008331358 6:50248208-50248230 CGTGACACAGAAACACAGAGAGG + Intergenic
1010794254 6:80101060-80101082 TGTCACAAAGCAGCACAAACTGG - Intergenic
1010954000 6:82069742-82069764 TGTAACAAAGTATCACAAACTGG - Intergenic
1011708749 6:90029500-90029522 CGTTATAAAGAAACATAAACAGG - Intronic
1011788024 6:90868041-90868063 TGTAACAAAGTACCACAAACTGG - Intergenic
1012149233 6:95725318-95725340 TGTAACAAAGTATCACAAACTGG + Intergenic
1012244447 6:96911088-96911110 CGTAACAAAGTACCACAAACTGG + Intergenic
1012300190 6:97577972-97577994 GGTGGCACAGAAAAACACACTGG + Intergenic
1012516618 6:100069243-100069265 GGAAAAAAAGAAACACAAAGAGG - Intergenic
1013580252 6:111527007-111527029 CGTAACAAAGTACCACAAACTGG + Intergenic
1013597056 6:111669861-111669883 GCTGAGAAATACACACAAACGGG + Intronic
1014313455 6:119833649-119833671 GGTAATAAAGAAAAACAAATTGG + Intergenic
1014622279 6:123683002-123683024 GGTGAGATGGAAACAGAAACTGG + Intergenic
1014760320 6:125349018-125349040 CATGACAAAGGATCACAAACTGG - Intergenic
1016535022 6:145100185-145100207 GGTGACAAAGAAAGGCAAGGAGG + Intergenic
1016720609 6:147292612-147292634 GGTAGCAAAGAAAGAAAAACAGG + Intronic
1016789477 6:148052876-148052898 GGACACAAAGAGACACATACAGG + Intergenic
1017048484 6:150369288-150369310 GGAGAGGAAGAAACACACACAGG + Intronic
1017766563 6:157611792-157611814 GGTCAAAAAGATGCACAAACAGG - Intronic
1018082526 6:160270723-160270745 GGTGACAAAGGACCGCAAACTGG - Intronic
1019114724 6:169751201-169751223 GGGAAAAAAGAAACACAAAAGGG + Intronic
1020588713 7:10106131-10106153 GTTGGCGAAGAAACACAAACTGG + Intergenic
1020827260 7:13044747-13044769 TGTAACAAAGTAACACAAACCGG - Intergenic
1020896368 7:13945090-13945112 TGTAACAAAGTATCACAAACTGG - Intronic
1022368561 7:29749425-29749447 GGAGGCAAAGAAAAAAAAACAGG - Intergenic
1022387927 7:29918764-29918786 CGTCACAAAGTACCACAAACTGG - Intergenic
1022497070 7:30859960-30859982 GGTGACAAATACAGACAAAGAGG - Intronic
1023092516 7:36630237-36630259 GGTTACAAAACACCACAAACTGG - Intronic
1023278852 7:38548922-38548944 GGTAACAAAGAAACAGAAGATGG + Intronic
1023639145 7:42240369-42240391 GGTAACAAAGTACCAAAAACTGG + Intergenic
1023845680 7:44118840-44118862 TGTAACAAAGCACCACAAACTGG - Intronic
1024192997 7:47031469-47031491 TGTGACAAGGAACCACAAACTGG - Intergenic
1024794628 7:53006770-53006792 TGTGATAAATAAACACTAACTGG - Intergenic
1025143744 7:56486650-56486672 GCTGGCAGAGAAACACAAACTGG - Intergenic
1025867997 7:65404272-65404294 GGGGACAAAGGAGGACAAACGGG + Intergenic
1026474271 7:70720652-70720674 GGTGACAAAGAAAGAGAGAAGGG - Intronic
1027388618 7:77682914-77682936 TGTAACAAAGTATCACAAACTGG + Intergenic
1027487659 7:78782106-78782128 GGTGAAAAAGTAGCACAAAATGG + Intronic
1027706679 7:81542972-81542994 TGTAACAAAGTAACACAAACTGG - Intergenic
1028124738 7:87099794-87099816 TGTAACAAAGTAACACAAACTGG + Intergenic
1029159712 7:98542995-98543017 TGTAACAAAGTACCACAAACTGG + Intergenic
1029295548 7:99537490-99537512 TGTAACAAAGTACCACAAACTGG - Intergenic
1030158286 7:106480010-106480032 GATGACAATGACACACAAATAGG - Intergenic
1030173345 7:106626890-106626912 TGTGACAAATTACCACAAACTGG - Intergenic
1030666668 7:112286367-112286389 TGTGACAAATAATCAGAAACAGG + Intronic
1030688724 7:112511454-112511476 TGTAACAAAGTACCACAAACTGG + Intergenic
1030737849 7:113070775-113070797 GGTGACAAAGAAAAAGAAATAGG + Intergenic
1030755877 7:113287271-113287293 AGTAACAAAGTACCACAAACTGG + Intergenic
1030778062 7:113561465-113561487 TGTAACAAAGTACCACAAACAGG + Intergenic
1030994908 7:116348620-116348642 GTTGAAAAAAAAGCACAAACAGG - Intronic
1031070479 7:117155980-117156002 GGTGACACATAAACAGAAACTGG - Intronic
1031522602 7:122784909-122784931 GGTGAAAAAGGAACATAAATAGG - Intronic
1031717905 7:125131645-125131667 GGTGAAAAAAAAAAAAAAACAGG - Intergenic
1031778197 7:125927855-125927877 GATCACAAATACACACAAACTGG - Intergenic
1033031954 7:137835575-137835597 GGGGAAAAAGAAAAAAAAACAGG - Intronic
1034531582 7:151699162-151699184 GGTGTCAAAGAGACACAACTTGG - Intronic
1034623797 7:152477003-152477025 GGTAACAAAGTAGCACAGACTGG + Intergenic
1035679524 8:1477790-1477812 GGTGAGAAAGAAAAAAAAAAAGG + Intergenic
1036535415 8:9645433-9645455 AGGGATAAAGACACACAAACAGG + Intronic
1036544848 8:9757658-9757680 GGTAACCAAGAAACAAAAAGTGG - Intronic
1038004681 8:23419531-23419553 CATGACAAAGCACCACAAACTGG + Intronic
1038892227 8:31738604-31738626 TGGTGCAAAGAAACACAAACTGG + Intronic
1039486987 8:37917883-37917905 GGAGAGAAAGAAACAAAATCAGG - Intergenic
1039834246 8:41243840-41243862 TGTAACAAAGTATCACAAACAGG - Intergenic
1041348729 8:56928243-56928265 TGTTACAAAGGACCACAAACTGG - Intergenic
1041524996 8:58795545-58795567 GGTGTCAAGGAAAAACAAAAAGG - Intergenic
1042105556 8:65322832-65322854 GGTGCCAAAGCAAACCAAACAGG + Intergenic
1042356553 8:67834846-67834868 TGTAACAAAGTACCACAAACTGG + Intergenic
1042458186 8:69029715-69029737 TGTAACAAAGAACCACAAACTGG - Intergenic
1042550754 8:69992185-69992207 TTTAAGAAAGAAACACAAACTGG - Intergenic
1043735641 8:83739715-83739737 TGTAACAAAGTACCACAAACTGG + Intergenic
1044269378 8:90223401-90223423 GAGGACAAAGGAACACAGACTGG - Intergenic
1045191881 8:99891702-99891724 CGTAACAAAGAACCACAGACTGG - Intronic
1045550825 8:103170724-103170746 TGTAACAAAGAACCAAAAACTGG - Intronic
1045969964 8:108068921-108068943 TGTGACAAAGTACTACAAACTGG - Intronic
1047047754 8:121073817-121073839 TGTAACAAAGCACCACAAACTGG - Intergenic
1047221727 8:122924107-122924129 TGTAACAAAGCACCACAAACTGG + Intronic
1047303919 8:123637979-123638001 TGTTACAAAGTACCACAAACTGG - Intergenic
1047407345 8:124596623-124596645 TGTAACAAAGCAACCCAAACTGG + Intronic
1047621769 8:126615057-126615079 GGTGAGAAAGAGACACAAAAGGG - Intergenic
1047955454 8:129971777-129971799 GCAGAGAAAGAAACACAAACAGG + Intronic
1048023849 8:130566110-130566132 GGTCAGAAAGTGACACAAACAGG - Intergenic
1048660428 8:136594077-136594099 GGAGAGGCAGAAACACAAACAGG - Intergenic
1048819341 8:138365952-138365974 GGTGAAAAAGAAAAAAAAAATGG - Intronic
1050460939 9:5876824-5876846 CGTAACAAAGTAACACAAATTGG - Intergenic
1051745642 9:20292540-20292562 TGTAACAAAGTACCACAAACTGG + Intergenic
1052579371 9:30334351-30334373 GATAACAAAGAAGCACAGACTGG - Intergenic
1053006093 9:34605631-34605653 GGATACAAAGACACACAAAAAGG + Intergenic
1054709991 9:68501611-68501633 GCTGAGAAAGCAACACAAGCAGG - Intronic
1054727430 9:68666272-68666294 TGTCACAAAGTATCACAAACTGG + Intergenic
1055011319 9:71569196-71569218 GGACACAGAGAAACACAGACAGG + Intergenic
1056035683 9:82602394-82602416 GGAGACAAGGAAACTCAGACTGG + Intergenic
1056760395 9:89410451-89410473 AGTCACAAAGAAACACAACCTGG + Intronic
1056960142 9:91116352-91116374 GCTGGCAAAGAAACACACATTGG + Intergenic
1057282613 9:93723617-93723639 CATGACAAAGTACCACAAACTGG + Intergenic
1057776875 9:98018489-98018511 GGTGAGACAGAAGCACAAAGTGG + Intergenic
1057962808 9:99473042-99473064 GGGAACACAGTAACACAAACAGG + Intergenic
1058000818 9:99863160-99863182 AGTGACATAGAAACACATCCAGG - Intronic
1058369104 9:104244151-104244173 TATGACAAAGTACCACAAACTGG - Intergenic
1059286127 9:113173082-113173104 GGAGACAAAGAAACAAAGATAGG - Intronic
1059811226 9:117857820-117857842 AGTTACAAAGAACCACAAACTGG + Intergenic
1059844507 9:118259310-118259332 ATTGAAAAAGAAAGACAAACAGG - Intergenic
1059989732 9:119853867-119853889 GGTGACAAAGACACATAGCCAGG + Intergenic
1060115924 9:120940682-120940704 GGTAACAAAGTGCCACAAACTGG + Intergenic
1060195694 9:121621954-121621976 AAAGAAAAAGAAACACAAACAGG - Intronic
1060195737 9:121622287-121622309 GGAGGGTAAGAAACACAAACGGG - Intronic
1060619188 9:125047552-125047574 GGAGACAAAGAAAGCAAAACTGG + Intronic
1060956713 9:127646665-127646687 GGTGACAAAAAAAAAAAAAAAGG - Intronic
1203546240 Un_KI270743v1:130502-130524 GAGAACAACGAAACACAAACGGG + Intergenic
1186402978 X:9276810-9276832 TGTAACAAAGTATCACAAACTGG + Intergenic
1186490088 X:9964595-9964617 GGAGACACACAAACACACACAGG + Intergenic
1186524388 X:10235125-10235147 GGTGAAAAAGAAATAGCAACGGG - Exonic
1186643154 X:11478873-11478895 GGGCACAAAGAAACAAAACCAGG + Intronic
1188634845 X:32416927-32416949 GGTAAAAAAGAAACACTAAAAGG - Intronic
1188690510 X:33123299-33123321 AGTGACACACAAACACACACAGG - Intronic
1188791255 X:34410657-34410679 CTTGAGAAAGAAAAACAAACTGG + Intergenic
1188968138 X:36580108-36580130 TGTAACAAAGTATCACAAACTGG + Intergenic
1189343178 X:40220022-40220044 TGTAACAAAGTACCACAAACTGG + Intergenic
1189597292 X:42582903-42582925 GTTCACAAAGAAGCAGAAACAGG + Intergenic
1190548821 X:51558062-51558084 GGTCCCAAAGAAACTCCAACTGG - Intergenic
1190968612 X:55327491-55327513 AGTGACCTAGAAACACCAACAGG - Intergenic
1191678153 X:63813352-63813374 GGTGACACTGATGCACAAACAGG - Intergenic
1191917137 X:66214765-66214787 GGTGGCAAAGCAACTCAAAGGGG - Intronic
1192411002 X:70932009-70932031 GGCCACAAGGAAAGACAAACAGG + Intergenic
1192808949 X:74533028-74533050 GGAGAAAAAGAGACACAAAGAGG - Exonic
1193752783 X:85366950-85366972 GGAGACAAATGAACAAAAACTGG - Intronic
1193797651 X:85896196-85896218 GGGAACAAAGAAAGACAATCAGG + Intronic
1194819960 X:98492894-98492916 GGGGACAAAGAGAGAAAAACAGG - Intergenic
1194831395 X:98626621-98626643 TGTGGCAAAGTACCACAAACTGG - Intergenic
1195284529 X:103371157-103371179 TGTAACAAAGTATCACAAACTGG + Intergenic
1196185065 X:112737037-112737059 TGTGAGAAAGAGACACATACAGG - Intergenic
1196363183 X:114891322-114891344 GTTGACAAAGAAACAGAAAGTGG - Intronic
1197863757 X:130996970-130996992 TGTAACAAAGTACCACAAACCGG - Intergenic
1198573957 X:137989629-137989651 TGTAACAAAGTACCACAAACTGG + Intergenic
1198884409 X:141318474-141318496 AGTAACAAAGTAACACACACGGG - Intergenic
1199755810 X:150864053-150864075 TGTAACAAAGTATCACAAACTGG - Intronic
1200358758 X:155579477-155579499 GGTGACAAAAACACACAATGGGG + Intronic
1201232740 Y:11880297-11880319 TATAACAAAGAACCACAAACTGG - Intergenic
1201293254 Y:12442206-12442228 GGTGACAAAGAAAGACCACCAGG - Intergenic