ID: 1117025567

View in Genome Browser
Species Human (GRCh38)
Location 14:51616547-51616569
Sequence CTGCTGCTGAGGAGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 781
Summary {0: 1, 1: 1, 2: 5, 3: 81, 4: 693}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117025567_1117025572 1 Left 1117025567 14:51616547-51616569 CCTTTTTTCCTCCTCAGCAGCAG 0: 1
1: 1
2: 5
3: 81
4: 693
Right 1117025572 14:51616571-51616593 GTTATGCTGGTGAAGGAAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 243
1117025567_1117025578 25 Left 1117025567 14:51616547-51616569 CCTTTTTTCCTCCTCAGCAGCAG 0: 1
1: 1
2: 5
3: 81
4: 693
Right 1117025578 14:51616595-51616617 TTTGGGGCTGATCCTAAGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 83
1117025567_1117025577 24 Left 1117025567 14:51616547-51616569 CCTTTTTTCCTCCTCAGCAGCAG 0: 1
1: 1
2: 5
3: 81
4: 693
Right 1117025577 14:51616594-51616616 TTTTGGGGCTGATCCTAAGGTGG 0: 1
1: 0
2: 1
3: 10
4: 108
1117025567_1117025574 8 Left 1117025567 14:51616547-51616569 CCTTTTTTCCTCCTCAGCAGCAG 0: 1
1: 1
2: 5
3: 81
4: 693
Right 1117025574 14:51616578-51616600 TGGTGAAGGAAGCTGGTTTTGGG 0: 1
1: 0
2: 1
3: 22
4: 276
1117025567_1117025573 7 Left 1117025567 14:51616547-51616569 CCTTTTTTCCTCCTCAGCAGCAG 0: 1
1: 1
2: 5
3: 81
4: 693
Right 1117025573 14:51616577-51616599 CTGGTGAAGGAAGCTGGTTTTGG 0: 1
1: 0
2: 6
3: 25
4: 247
1117025567_1117025579 26 Left 1117025567 14:51616547-51616569 CCTTTTTTCCTCCTCAGCAGCAG 0: 1
1: 1
2: 5
3: 81
4: 693
Right 1117025579 14:51616596-51616618 TTGGGGCTGATCCTAAGGTGGGG 0: 1
1: 0
2: 2
3: 8
4: 116
1117025567_1117025576 21 Left 1117025567 14:51616547-51616569 CCTTTTTTCCTCCTCAGCAGCAG 0: 1
1: 1
2: 5
3: 81
4: 693
Right 1117025576 14:51616591-51616613 TGGTTTTGGGGCTGATCCTAAGG 0: 1
1: 0
2: 0
3: 12
4: 198
1117025567_1117025571 -6 Left 1117025567 14:51616547-51616569 CCTTTTTTCCTCCTCAGCAGCAG 0: 1
1: 1
2: 5
3: 81
4: 693
Right 1117025571 14:51616564-51616586 CAGCAGTGTTATGCTGGTGAAGG 0: 1
1: 0
2: 0
3: 9
4: 161
1117025567_1117025575 9 Left 1117025567 14:51616547-51616569 CCTTTTTTCCTCCTCAGCAGCAG 0: 1
1: 1
2: 5
3: 81
4: 693
Right 1117025575 14:51616579-51616601 GGTGAAGGAAGCTGGTTTTGGGG 0: 1
1: 0
2: 1
3: 19
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117025567 Original CRISPR CTGCTGCTGAGGAGGAAAAA AGG (reversed) Intronic
900158100 1:1211620-1211642 CTCCCCCTGGGGAGGAAAAAAGG + Exonic
900252566 1:1678718-1678740 GTGCTGCTGAACAGGAAGAAGGG - Intronic
900401429 1:2474443-2474465 CTGCTGCTGAGGAGGTCAGGGGG + Intronic
900821351 1:4891531-4891553 TGGCTGCTGAGAAGGTAAAATGG + Intergenic
901110562 1:6790258-6790280 CTCCTGCTGAGGAGGAAAAAAGG - Intronic
901242083 1:7701321-7701343 CTGTTGCAGAGGAGGAAGAAGGG - Intronic
901372541 1:8811918-8811940 CTCCTGCTGAGGAGGCAACAAGG + Intronic
902070328 1:13729296-13729318 GTGCTCCTGGGGAGGATAAATGG + Intronic
902895593 1:19477645-19477667 CTGCAACTGAGAAGGGAAAAGGG + Intronic
903955919 1:27025560-27025582 CTGCTAGTGAGAATGAAAAATGG - Intergenic
904235986 1:29117560-29117582 CTGCTTCTGATGAGGTAAAAGGG - Exonic
904313777 1:29646631-29646653 CTGCCTCTGAGGAGTGAAAAGGG + Intergenic
904528575 1:31153638-31153660 CTGCTGGTGAGAATGGAAAATGG + Intergenic
905514824 1:38554784-38554806 CTGCTGGTGGGGATGTAAAATGG + Intergenic
905600171 1:39243044-39243066 CTGCTGGTGAGGATGTAAAATGG - Intronic
905612249 1:39364113-39364135 CTGCTGCTGGGAATGCAAAATGG - Intronic
905688590 1:39926511-39926533 CTGCTGATGTGGAGGAGAGATGG - Intergenic
906100429 1:43256948-43256970 CAGCTGGTGAGGAGGAAGTATGG + Intronic
906421306 1:45670098-45670120 CTGCTGCTGATGGTGAAAACTGG - Intronic
906535862 1:46550626-46550648 CAGCTGCTGTGGAGGCAAACAGG + Intronic
907112728 1:51941005-51941027 CATATGCTGAGGAGGAAAACTGG + Intronic
908337177 1:63138502-63138524 CTGCTGGTGAGAATGTAAAATGG + Intergenic
908947071 1:69511141-69511163 CTGCTGCAGAGGAAGAAGTAGGG - Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910174808 1:84417955-84417977 CTGGTGATGATGAGGAGAAAGGG - Intergenic
910395664 1:86791316-86791338 CTGTTGATGAGGAGGTAAATTGG + Intergenic
910473571 1:87581314-87581336 TTGCTGATGAGAAGGTAAAATGG - Intergenic
910703663 1:90103726-90103748 CTGCTTCTGAGCAGGCATAAAGG - Intergenic
910792197 1:91063290-91063312 CTGGCGCTAAGGAGGAAAAGAGG + Intergenic
910905409 1:92172695-92172717 TGGCTGATGAGGAAGAAAAAAGG - Intronic
911053391 1:93691322-93691344 CTGTTGCTGAGTGGGAAAAATGG + Intronic
911417499 1:97593209-97593231 CTGTCCCTGAGGAGGTAAAATGG - Exonic
911754979 1:101543705-101543727 CTGCTGCTGCTGGGTAAAAACGG + Intergenic
911840535 1:102675974-102675996 CAGAGGCTGAGGAAGAAAAACGG - Intergenic
912420378 1:109538696-109538718 CTGCCTCTAAGAAGGAAAAAGGG - Intergenic
912561118 1:110552182-110552204 CTGCTTCTGAGGAAGAAAGTTGG + Intergenic
912658526 1:111508430-111508452 CTGCTGCCGAGAAAGAAAACGGG + Intronic
912722620 1:112032857-112032879 CTGCTGCTGAGGTGGCCAATGGG - Intergenic
913132360 1:115852569-115852591 CTGATGATGATGTGGAAAAAGGG - Intergenic
913185810 1:116369932-116369954 CTGCTGCTGAACAGAAGAAAAGG + Intergenic
913324543 1:117615327-117615349 CTGCTGGTGAGTAGCAGAAATGG - Intronic
913327917 1:117643763-117643785 CTGCTGGTGAGAATGCAAAATGG - Intergenic
913469421 1:119174169-119174191 CTCCTTCTGATGGGGAAAAATGG + Intergenic
913521921 1:119652716-119652738 CTGCAGATGAGGAGGACTAATGG - Intergenic
915125765 1:153662947-153662969 CTGCTGCTCAGCAGGCAAAGCGG - Intronic
915961304 1:160269147-160269169 CTGCTGCTGTGAATGTAAAATGG - Intergenic
915974579 1:160376525-160376547 CTGCAGCTGAGGAGAAGAAGGGG + Intergenic
916053017 1:161049206-161049228 CTGAAGTTGAGGAGGAAAATGGG - Exonic
916644301 1:166767363-166767385 CTGAATCTGAGGAGGAACAAAGG - Intergenic
916849611 1:168690206-168690228 CTGCAGAGGAGGAGAAAAAACGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917516763 1:175714886-175714908 CTGCTGCTGACCAGGGAAAGGGG - Intronic
917992548 1:180396837-180396859 CAGCTGCTGGGCATGAAAAATGG + Intronic
918091454 1:181298591-181298613 CTGCTACAGAGGAGGAAATGAGG + Intergenic
918313259 1:183301894-183301916 TTGCAGCTGAAAAGGAAAAATGG - Intronic
918429454 1:184443872-184443894 CTGCTGGGGAGGAGGTAAGAAGG + Intronic
918439720 1:184555121-184555143 TAGGTGCTGAGCAGGAAAAATGG - Intronic
918636655 1:186782803-186782825 CTGCTGCTGACTCGGAAGAAGGG + Intergenic
919925648 1:202190581-202190603 CTGCTGCTGAGGTTGAAACAGGG + Intergenic
920257295 1:204664288-204664310 CAGCTGCAGAGGAGGAATAAAGG - Intronic
920319242 1:205105163-205105185 CTCCAGCTGAGGAAAAAAAAGGG + Exonic
920563880 1:206958660-206958682 CTGCAGCTCAGGAGGCAGAAAGG - Exonic
920899468 1:210092471-210092493 ATGCTGCTTAGGAGAAAAAGAGG + Intronic
920988037 1:210908815-210908837 CTTCTGCAAAGGAGGAACAAAGG + Intronic
921344153 1:214164702-214164724 CTACTACTGAGGAGAAAAAATGG + Intergenic
921539322 1:216394218-216394240 TTGCTGGTGAGAAGGCAAAATGG + Intronic
921563083 1:216681802-216681824 TTGCTGCTGTGGGGGAGAAAAGG + Intronic
921988312 1:221336251-221336273 CTGTTTATGAGGAGGAAAAGAGG - Intergenic
922522065 1:226262677-226262699 CTGCTGCTGGGAATGCAAAATGG + Intronic
922769135 1:228172735-228172757 CTGCTGGTGGGGAGGCAAAACGG - Intronic
923664555 1:235988421-235988443 CTGCTGGTGAGTAGGTAAAATGG + Intronic
923691098 1:236193473-236193495 CTGCTGGTGAGAATGTAAAATGG - Intronic
924074350 1:240317846-240317868 TTGCTGCTGAGAATGGAAAATGG - Intronic
924736970 1:246766631-246766653 CTGCTGCTGAGAAGTAAACCAGG + Intronic
1062766370 10:68953-68975 CATCTGCTCAGGAGGAAACACGG - Intergenic
1062972862 10:1661891-1661913 CTGCTGCTGGGGAGGGAAAGGGG + Intronic
1063021437 10:2132909-2132931 CTGCTGATGAGAAGGAAAAATGG + Intergenic
1063604571 10:7510966-7510988 CTGCTGCTGGGAATGCAAAATGG - Intergenic
1063932468 10:11043106-11043128 CTGCTGGTGGGAAGGTAAAATGG - Intronic
1064091045 10:12385145-12385167 CTGCTGGTGTGGATGTAAAATGG + Intronic
1064484906 10:15776324-15776346 TTGCTGGTGAGGATGTAAAATGG - Intergenic
1067112000 10:43407765-43407787 GCGCAGCCGAGGAGGAAAAAGGG + Intronic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1067790676 10:49285056-49285078 CTGCTGGTGGGGATGAAAAATGG + Intergenic
1067813343 10:49449076-49449098 CTGCTGGTGAGAATGTAAAATGG - Intergenic
1068226123 10:54108736-54108758 CTTCTGCTGAGGAGAGAAGAGGG + Intronic
1068444926 10:57108700-57108722 CTGCTGCTGGGAAGGAACAGGGG - Intergenic
1069024851 10:63528513-63528535 CTGCTGTTGAGGAGGGACAAGGG - Intronic
1069067387 10:63957630-63957652 CTGCTGGTGAGAATGTAAAATGG - Intergenic
1069218054 10:65846965-65846987 ATGTTGCTCAGAAGGAAAAAAGG + Intergenic
1069584920 10:69593079-69593101 CCGCTGTTGAGGGGGGAAAATGG - Intergenic
1069681905 10:70291525-70291547 CTGCTGCTGTGCAAGAGAAAGGG - Intergenic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1070218884 10:74419189-74419211 CTGTTGTTGGGGAGGAAGAATGG - Intronic
1070483120 10:76904647-76904669 CTCCTTCTGAGGAGAAAAAGGGG - Intronic
1070690853 10:78524060-78524082 TTGCTGGTGAGCAGGAAAATGGG - Intergenic
1071138161 10:82476249-82476271 CTGCTGGTAAGGATGTAAAATGG + Intronic
1071167583 10:82824467-82824489 TTGCTGGTGAGAATGAAAAATGG - Intronic
1071216422 10:83407681-83407703 TTGCTGCTGCGAATGAAAAATGG + Intergenic
1073448361 10:103594378-103594400 TCTCTGCTGAGGAGGAAAGAAGG + Exonic
1074351412 10:112740713-112740735 CTGCTGGTGAGAATGTAAAATGG + Intronic
1074505822 10:114069590-114069612 CTGGCTCTGGGGAGGAAAAAAGG - Intergenic
1074604634 10:114949317-114949339 CTGCTGCTGATGAGGCAAACAGG - Intronic
1074618200 10:115092362-115092384 GTGCTGCTGAGGAAGGAAAACGG + Intergenic
1074963908 10:118472193-118472215 TTACTGCTGAGGGGGAAAAGAGG + Intergenic
1075113221 10:119604718-119604740 CTGCTGCTGGGAATGTAAAATGG + Intergenic
1075604287 10:123793153-123793175 CAGTTGCTGAGGAGCAAAAGTGG + Intronic
1077081609 11:726884-726906 CTGCTTCTAGGGAGGAGAAATGG - Exonic
1077238808 11:1499795-1499817 CTGCTGGTGGGGATGCAAAATGG + Intronic
1077660247 11:4061536-4061558 TTGCTGGTGAGAAGGTAAAACGG + Intronic
1078007410 11:7542499-7542521 CTGCATCTGAGGAAGAACAATGG - Intronic
1078908370 11:15708305-15708327 CTGCTGCTGCAGAGGAAGTAAGG - Intergenic
1078917693 11:15795399-15795421 CTACTGCAGAGGAGGATAATTGG - Intergenic
1079041350 11:17063233-17063255 CTGCTGGTGGGGAGGAAATGAGG - Intergenic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1079625392 11:22611106-22611128 CAGATGCCTAGGAGGAAAAATGG - Intergenic
1080263146 11:30372422-30372444 CTGCTGATGAGGATGCAAACTGG - Intergenic
1080788656 11:35499533-35499555 CTGCTGCTTAGGGGGAAACAGGG - Intronic
1080932666 11:36829050-36829072 CTGCTGCTGGGAATGAAAATTGG - Intergenic
1081949103 11:47027450-47027472 CTGCTGCTAAGGAAGAAAGACGG - Intronic
1081992304 11:47344372-47344394 CTGCTGCAGTGGGGGAAATAGGG + Intronic
1082001267 11:47394840-47394862 CTGCTGCCGATGTGGAAACAGGG - Intergenic
1083019354 11:59490554-59490576 ATGCTGCTGTGGAGGTCAAAAGG - Intergenic
1083110364 11:60400272-60400294 CTGATGCTCAGGTGGAAAAACGG + Intronic
1084507583 11:69578335-69578357 CTGCTGCTGAGAATGCAAAATGG - Intergenic
1085094826 11:73751630-73751652 ATGCTGCTGAGAAAGAAAAACGG + Intronic
1085403026 11:76245861-76245883 TTGGTCCTGAGAAGGAAAAAAGG + Intergenic
1085787758 11:79470055-79470077 ATGCTGCAGGGGAGGAGAAATGG - Intergenic
1086009437 11:82081893-82081915 CAGCTGCTGAGCAAGAAATAGGG - Intergenic
1086977097 11:93145617-93145639 CTGCTACTGAGGGGAAAGAAAGG - Exonic
1087170370 11:95043526-95043548 CTTGTTCTGAGGAGGAAAAGAGG - Intergenic
1087466411 11:98512250-98512272 CTATTGGTGAGGAGGTAAAATGG - Intergenic
1088038169 11:105343709-105343731 ATGCTGGTGAGGTGGAGAAATGG + Intergenic
1088069887 11:105769382-105769404 CAGATGATGTGGAGGAAAAAGGG + Intronic
1088291225 11:108239738-108239760 CTGCTGGTGAGAATGTAAAATGG - Intronic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1089110433 11:116051622-116051644 CTCCTGGTGAGGAGTCAAAACGG + Intergenic
1089210535 11:116797912-116797934 CTGCTGCTGGAAAGGTAAAATGG + Intergenic
1089307942 11:117538483-117538505 CAGCTCCTGAGGAGGAAGGAGGG - Intronic
1089729551 11:120511792-120511814 CTGCTGCGGAAGAGGAAAAACGG + Exonic
1089777967 11:120852231-120852253 CTGCTGCTGAGGAGGTAAGAGGG + Intronic
1090466098 11:126935259-126935281 CTGCTGCTGGGAAGGCAAAATGG + Intronic
1090515871 11:127426017-127426039 CTGCAGCGGAAGAGGAAGAAAGG + Intergenic
1090663031 11:128895276-128895298 CTGCTGCTCAGAAAGGAAAATGG + Intronic
1090980500 11:131716467-131716489 CTGCTGGTGGGAATGAAAAATGG - Intronic
1091602689 12:1927684-1927706 CTGAGGCTGAGGAGGACAAGGGG + Intergenic
1091977983 12:4842063-4842085 CTGCTGATGAGGAGGAGGAGTGG + Intronic
1092061559 12:5555291-5555313 TTGCTGCTGTGGAGGAGAACAGG + Intronic
1092551840 12:9510665-9510687 CAGATGCTGAGCAAGAAAAAAGG + Intergenic
1092904130 12:13086901-13086923 CAGCTGATGAGCAGGAAAACTGG + Intronic
1093246580 12:16745588-16745610 CTGGTGAGGATGAGGAAAAAAGG + Intergenic
1093318828 12:17686626-17686648 TTGCTGCTGGGAATGAAAAATGG - Intergenic
1093654237 12:21676634-21676656 TTGCTTCTGGGGAGGAAGAAAGG + Intronic
1093692620 12:22125181-22125203 CAGAGGCTTAGGAGGAAAAATGG + Intronic
1094279787 12:28723489-28723511 CTGATGCTGAGGCTGAAACAAGG + Intergenic
1094453045 12:30602082-30602104 CTGCTGGGGAGATGGAAAAAAGG + Intergenic
1094520280 12:31179955-31179977 CAGATGCTGAGCAAGAAAAAAGG - Intergenic
1094766117 12:33596553-33596575 CTGCGGTTGGGGAGGAGAAAGGG + Intergenic
1095195805 12:39315241-39315263 CTGCTGATGATCAGCAAAAATGG + Intronic
1095389958 12:41694089-41694111 CTGCTGATGAGGAAAAAAAATGG + Intergenic
1096039920 12:48506075-48506097 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1097260421 12:57716676-57716698 CTGCTCCTGACGAGGAGAAAAGG - Exonic
1097408407 12:59220810-59220832 CTGCTGCAGAGAAAGAAAAAAGG + Intergenic
1098323935 12:69280454-69280476 CTGCTGGTGAGAACGTAAAATGG - Intergenic
1099464410 12:82965543-82965565 ATGCAGCTGAGGGGGAAAAGTGG - Exonic
1100291140 12:93215893-93215915 CTGCTAATGAGGGGGCAAAAGGG - Intergenic
1100666649 12:96761064-96761086 CTGCTGGTAAGGATGTAAAATGG - Intronic
1101441630 12:104708495-104708517 ATCCTGGTGAGGAGGAAACAAGG + Intronic
1101663041 12:106783980-106784002 CCTATGCTGAGGGGGAAAAAAGG - Exonic
1101708881 12:107246578-107246600 CTGCTGCTGAGAATGTAAAATGG + Intergenic
1102582909 12:113902732-113902754 ATGCTGCTCAGCAGTAAAAAGGG - Intronic
1102923636 12:116810762-116810784 CTGCTCCTGAGGGGGAAGACAGG + Intronic
1103325385 12:120116791-120116813 CGGCTGCTGAGGAGGAGGAGGGG - Exonic
1103912011 12:124357018-124357040 CTGCCGCTGAGGACGAGAACGGG + Intronic
1104197998 12:126559709-126559731 TTATTGCTGAGGAGGAAAAGAGG + Intergenic
1104393717 12:128413464-128413486 TTGCTGCTGAGAATGAAAAGCGG - Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104566912 12:129893641-129893663 CTTCTGCTGAAGGGGAAAAATGG - Intronic
1105343689 13:19553334-19553356 CTGCTGCTGGGAAAGTAAAATGG + Intergenic
1105536355 13:21268300-21268322 CTGCTGCTGGGAACGTAAAATGG - Intergenic
1105755419 13:23459229-23459251 GTTCTGCTGAAGAGGAAAGATGG - Intergenic
1105892184 13:24689720-24689742 CTGGGGCTCAGGAGCAAAAATGG - Intronic
1106370496 13:29127832-29127854 ACGCTGCTTAGCAGGAAAAATGG - Intronic
1107144583 13:37045252-37045274 CTGATGCTCAGGGGAAAAAACGG - Exonic
1108129458 13:47282133-47282155 ATGATGCGGAGGAGGCAAAATGG - Intergenic
1108620331 13:52176679-52176701 CTGCTGCTGGGAACGTAAAATGG + Intergenic
1108666409 13:52636371-52636393 CTGCTGCTGGGAACGTAAAATGG - Intergenic
1108820585 13:54345080-54345102 CTGTTACAGAGTAGGAAAAATGG + Intergenic
1108917955 13:55639551-55639573 CTGCTACTAAGGAAGAAAATGGG - Intergenic
1109263561 13:60170770-60170792 CTGCTGGTGAGAATGCAAAATGG - Intergenic
1109742280 13:66569768-66569790 ATGCTGGTGAGGAGGAAGACAGG + Intronic
1110214863 13:73014085-73014107 CAGCTACTAGGGAGGAAAAAGGG - Intronic
1110625912 13:77655444-77655466 CTGCTGCGGATGTGGAGAAAGGG - Intergenic
1110811359 13:79813779-79813801 CTGCTGGTGAGAATGGAAAATGG - Intergenic
1111079149 13:83279359-83279381 CTGCCGCTCAGAAGAAAAAAAGG + Intergenic
1111294500 13:86261151-86261173 CTGCTGATGAGAATGTAAAATGG - Intergenic
1111497988 13:89077832-89077854 CTGGTGCAGATGTGGAAAAACGG - Intergenic
1111987642 13:95080958-95080980 CTGCTGCTGAGAAGAAACAGTGG + Intronic
1112244752 13:97721877-97721899 CTGCTGGTGGGGACGTAAAATGG + Intergenic
1112641068 13:101275653-101275675 CTGTAGCTGGGGAGGAAGAAGGG + Intronic
1112825077 13:103382568-103382590 CTGAGGCCTAGGAGGAAAAATGG - Intergenic
1113651637 13:112037365-112037387 CTGCTGCTGAGGGGAGACAACGG + Intergenic
1114443994 14:22773977-22773999 CTGATGATGAGGAAGTAAAAGGG + Exonic
1115051893 14:29072815-29072837 CAGAGGCTTAGGAGGAAAAATGG - Intergenic
1115632354 14:35257810-35257832 CTGCAGAGGAGGAGGTAAAAAGG + Intronic
1116003669 14:39270061-39270083 CTGCTGGTGGGGATGTAAAATGG - Intronic
1116261488 14:42634032-42634054 ATGCTGCTGGGGAAAAAAAATGG + Intergenic
1116428308 14:44817435-44817457 CTGCTGCTGTGGAAGAGTAATGG - Intergenic
1117025567 14:51616547-51616569 CTGCTGCTGAGGAGGAAAAAAGG - Intronic
1117057892 14:51931727-51931749 CTGCTGGTGAGAACGTAAAATGG + Intronic
1118002236 14:61534112-61534134 CTGCTGATGAGGATGTAAAATGG + Intronic
1118313106 14:64707144-64707166 CTTCTGCTGAGGAGGGAGGATGG - Intronic
1119023064 14:71131317-71131339 CTCCTGGTGAAGAAGAAAAAAGG - Intergenic
1119284542 14:73441956-73441978 CTGCTGGTGAGAATGTAAAATGG + Intronic
1119510528 14:75207649-75207671 CTGCTGCGGAGGTGGGGAAAAGG + Intergenic
1119865980 14:77974859-77974881 CTACTGCTGCAGTGGAAAAAGGG + Intergenic
1120600182 14:86494391-86494413 CTGCTGCAGATGTGGAGAAAAGG - Intergenic
1121062735 14:90930931-90930953 CTGCTGGTGAGAATGTAAAATGG + Intronic
1121190676 14:92026663-92026685 CCCCTGCTGACGAGGAAAATGGG + Intronic
1121475063 14:94191984-94192006 CTGATGCTCAGGAAAAAAAATGG - Intronic
1121613555 14:95297694-95297716 ATACTGCTCAGGAGGAAGAAGGG - Intronic
1121755098 14:96395592-96395614 CAGCTGCTCAGGAGGCAGAATGG + Intronic
1121864911 14:97353719-97353741 ATGTGGCTGAGGAGGAAGAAAGG - Intergenic
1122012272 14:98759985-98760007 CTGGAGCTCAGGAGGAAAAATGG - Intergenic
1122864739 14:104598490-104598512 CAGCTGCTGATGAGGCAAAGTGG + Intronic
1122957943 14:105080189-105080211 CTGCTGGTGAGAATGCAAAATGG - Intergenic
1202841260 14_GL000009v2_random:124039-124061 GTGCTTCAGAGGAGGATAAAAGG - Intergenic
1202910649 14_GL000194v1_random:114269-114291 GTGCTTCAGAGGAGGATAAAAGG - Intergenic
1202881945 14_KI270722v1_random:68389-68411 GTGTTTCAGAGGAGGAAAAAAGG + Intergenic
1123702223 15:22923508-22923530 CTGCTGGTAAGAAGGAGAAATGG + Intronic
1123972763 15:25524301-25524323 CTGCTGGTGAGAATGCAAAATGG + Intergenic
1124103761 15:26718661-26718683 CTGCTGCTAAGGAGGAAAGGTGG - Intronic
1124465514 15:29935962-29935984 TTGCTGCTGAGGACCAGAAAAGG - Intronic
1124508348 15:30298761-30298783 CTGCTGGTGTGAATGAAAAATGG - Intergenic
1124735209 15:32239895-32239917 CTGCTGGTGTGAATGAAAAATGG + Intergenic
1126069907 15:44857022-44857044 GGGCTGCTGAGGGGGTAAAATGG - Intergenic
1126088622 15:45032140-45032162 GGGCTGCTGAGGGGGTAAAATGG + Intronic
1126376324 15:48000535-48000557 CTGCTGGGGAGGAGGAGAGAAGG - Intergenic
1126432974 15:48606116-48606138 CTGCTGGTGAGAATGCAAAATGG + Intronic
1126584091 15:50266097-50266119 CTACTGCTGATAAGGAAACAGGG - Intergenic
1126913382 15:53438232-53438254 CTGCTGCCCAGGAAGAAAAGGGG + Intergenic
1127001864 15:54518260-54518282 GTGCTGCTGAGGAGGTTGAAAGG + Intronic
1127012281 15:54643678-54643700 CTGCTGCTGGGGATGGAGAAGGG - Intergenic
1127163070 15:56211918-56211940 CTGCTGGTGGGGATGCAAAATGG + Intronic
1127174929 15:56344059-56344081 CTGCTGGTGAGAATGTAAAATGG + Intronic
1127331825 15:57947370-57947392 CTTCTGCTGAGGAGGCAGGAAGG - Intergenic
1127608475 15:60614290-60614312 CTGCTGGGGAGGAGGAAGGAAGG + Intronic
1127816431 15:62613467-62613489 CTGCTGGTGAGAATGGAAAATGG + Intronic
1128012002 15:64306527-64306549 CTGCTGGTGAGAATGCAAAATGG + Intronic
1128378422 15:67093671-67093693 CTGCTGCTAAGAAGGGAAAGAGG + Intronic
1128416897 15:67455003-67455025 CTGCTAGTGAGGTGGCAAAATGG - Intronic
1129164962 15:73771694-73771716 TTGTTTCTGAGGAGGAAACAAGG - Intergenic
1129683316 15:77670774-77670796 CTGCTGCTGGGCAGGGAAGATGG + Intronic
1129828186 15:78649150-78649172 CTGCTGCTGGGGATGTAAACTGG + Intronic
1130112786 15:80979789-80979811 CTGCTGCTGGGGAGGTAAAGAGG + Intronic
1131334483 15:91534807-91534829 TTGCTAGTCAGGAGGAAAAAGGG - Intergenic
1131886703 15:96923335-96923357 ATGGAGCTGAGGTGGAAAAAAGG + Intergenic
1132239018 15:100243414-100243436 CTGCTGGTGAGAATGCAAAATGG - Intronic
1132245658 15:100294350-100294372 CTCCTGCAGAGTAGGAAATACGG - Intronic
1132246723 15:100302506-100302528 CTGCTGTTGAGAATGTAAAATGG - Intronic
1132278913 15:100595553-100595575 CTGCTGGTGAGAATGAAAAACGG + Intronic
1132704143 16:1235178-1235200 CTGCTGATGAGAAGGCAGAATGG - Intergenic
1132707376 16:1251246-1251268 CTGCTGATGAGAAGGCAGAATGG + Intergenic
1133135291 16:3706969-3706991 CTGCTGGTGAGAATGTAAAACGG - Intronic
1133138486 16:3728570-3728592 CTGCTGCTGTGGAGGCACACCGG + Exonic
1133340548 16:5033153-5033175 ATTCTGCAGAGGAGGAAACAGGG + Intronic
1134856866 16:17527334-17527356 GAGCTGCTGTGGAGGAAACAAGG - Intergenic
1135124245 16:19794587-19794609 CTGCTGATGAGAATGTAAAATGG + Intronic
1135696497 16:24592188-24592210 CTGCTGGTGAGAATGTAAAATGG - Intergenic
1135977781 16:27122100-27122122 CTGCTGATGAGAATGGAAAATGG + Intergenic
1136059833 16:27718889-27718911 CAGCTGCGGTGGAGGACAAAGGG - Intronic
1137364002 16:47844886-47844908 CTGCTGCTGGGAATGTAAAATGG + Intergenic
1137765817 16:50976892-50976914 ACCCTGCTGAAGAGGAAAAAGGG - Intergenic
1138659306 16:58508247-58508269 GTGCTGCTGGGGAGGGAAGAGGG - Intronic
1138661343 16:58519888-58519910 CTGGTGGTGAGGAGGAAAAGTGG - Intronic
1139159739 16:64490131-64490153 CAGCTGTTGAGGAAAAAAAAAGG + Intergenic
1139191009 16:64862980-64863002 TTGGTGATGAGGAGGAGAAAAGG - Intergenic
1139253158 16:65516086-65516108 CTGCTGCTGAGGAGGATCTGGGG - Intergenic
1139265835 16:65637440-65637462 CAGCTGATGAGGAGGAAGATGGG - Intergenic
1139567414 16:67787423-67787445 CTGCTGGTGGGGATGTAAAATGG + Intronic
1139632327 16:68238028-68238050 CTCAGGCTGAAGAGGAAAAAGGG - Intronic
1140108153 16:71979998-71980020 CTGCTGCTGAGCAGGTTAATGGG - Exonic
1141302818 16:82833792-82833814 CAGCTACTGGGGAGGGAAAACGG + Intronic
1141458722 16:84163279-84163301 CTGCTGATGGGGATGTAAAATGG - Intronic
1142021380 16:87785000-87785022 CGGCCCCTGAGCAGGAAAAATGG - Intergenic
1142220042 16:88849813-88849835 CTGAAGCTGATGAGGAAGAAAGG + Intronic
1142527301 17:552742-552764 CTGCATCTGAGGAGGTACAATGG + Intronic
1142882927 17:2895316-2895338 CTGCCTCTGAGGAGGAGAAGGGG - Intronic
1143161086 17:4871771-4871793 CTGCTGCTGGGAATGTAAAATGG - Intronic
1143436600 17:6932840-6932862 TTGCTGGTGGGGATGAAAAATGG + Intronic
1143784239 17:9244906-9244928 CTTCTGCTCAGGAAGAAATAGGG + Intergenic
1143817776 17:9532518-9532540 CTGCTTCTGGGGAAGAAAATGGG + Intronic
1143870789 17:9956192-9956214 CTGCAGCAGAGAAGGGAAAATGG + Intronic
1144237388 17:13274805-13274827 CTGATTCTGATGAGAAAAAAAGG + Intergenic
1144996015 17:19269293-19269315 CTCCAGCAGAGGAGGAAAGAGGG + Intronic
1146468316 17:33104624-33104646 CTGCTCCTGAAGAAGAAAAGAGG + Intronic
1146486438 17:33246592-33246614 CCCCTGCTCAGGAGGAAATAAGG + Intronic
1146599890 17:34205144-34205166 CACCTGCTGAGGAGGATAAGAGG - Intergenic
1146821519 17:35986603-35986625 ATGGTGATGAGGAGGAAGAAGGG + Exonic
1147903330 17:43805363-43805385 CTGCTGCTGGGAATGTAAAATGG + Intronic
1147921401 17:43919340-43919362 CTGCTGCTACGGGGGAAGAAAGG - Intergenic
1148069690 17:44901060-44901082 CTGCTGATGAGAAGTACAAACGG + Exonic
1148291664 17:46456881-46456903 CTGATGCTGAAGAGGAGCAAAGG + Intergenic
1148313854 17:46674588-46674610 CTGATGCTGAAGAGGAGCAAAGG + Exonic
1148561494 17:48609345-48609367 ATGCTGATGAGCAGAAAAAATGG + Intronic
1148841335 17:50499497-50499519 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1148913525 17:50955918-50955940 CTGCTGCTGAAAGGGAGAAAAGG - Intergenic
1149232602 17:54553190-54553212 ATGCTGATAAGGAGGAAAGAGGG - Intergenic
1150291903 17:63987208-63987230 CTGTTGCTGATGAGGCAGAATGG + Intergenic
1150535532 17:66035487-66035509 CTGCTGGTGAGAATGAAAAATGG + Intronic
1150821181 17:68435713-68435735 CTGTTGGTGAAAAGGAAAAATGG + Intronic
1150821186 17:68435742-68435764 ATGCTGCGGAGGAGGGAAGATGG + Intronic
1151007279 17:70452168-70452190 TTGCTGGTGAGAAGGCAAAATGG + Intergenic
1152370118 17:79882059-79882081 CTGCTGCTGGGAATGCAAAATGG - Intergenic
1152959239 18:68524-68546 CATCTGCTCAGGAGGAAACACGG - Intronic
1152996635 18:413390-413412 CTGCTGGTGAGAATGTAAAATGG + Intronic
1153322220 18:3784656-3784678 CTGCTCCTGACGAGGAAAAAAGG + Intronic
1153429343 18:4999080-4999102 CTGCTGCTGGGGATGAAGGAGGG - Intergenic
1153485148 18:5590440-5590462 CTGCTGTCGAGGATGCAAAATGG + Intronic
1153624175 18:7007522-7007544 CTGCTGGTGAGAATGGAAAATGG + Intronic
1153791835 18:8586217-8586239 CAGCTCCCAAGGAGGAAAAATGG + Intergenic
1155332276 18:24730466-24730488 TTGCAGATGAGGAGGAGAAAAGG + Intergenic
1155781466 18:29841981-29842003 TTGCTGGTGTGGATGAAAAATGG - Intergenic
1157390194 18:47295379-47295401 CTGCCTCTGGGGAGGAAGAAAGG - Intergenic
1157602072 18:48899812-48899834 CTGCTGGTGGGGATGTAAAATGG + Intergenic
1157753578 18:50198665-50198687 CTAGTGGTGAGGAGGAGAAAGGG - Intergenic
1158309116 18:56139825-56139847 CTGCTGCTGCAGAGGAATGAGGG - Intergenic
1158986629 18:62824186-62824208 CTGGTGCTGGGGATGTAAAATGG + Intronic
1159005814 18:63009590-63009612 CTGCTGGTGACGATGCAAAAGGG - Intergenic
1159121065 18:64171567-64171589 ATGTTGCAGAGGATGAAAAATGG - Intergenic
1159958660 18:74538636-74538658 CTGCTAGTGAGGATGCAAAATGG - Intronic
1160157141 18:76442579-76442601 CTGCTGCGGAGCAGCAAGAAGGG - Exonic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160496799 18:79380708-79380730 CTGCTGCTGAGTGGGACCAAGGG - Intergenic
1160582895 18:79897783-79897805 CTGTTGCTGGGGAGGAAGAGGGG - Intronic
1161475512 19:4482763-4482785 ATTCTGCAGATGAGGAAAAAAGG - Intronic
1161773793 19:6246179-6246201 CTGCTGATGAGGCTGCAAAATGG + Intronic
1162537829 19:11274224-11274246 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1162630115 19:11920928-11920950 CTGCTGCTGAGGGTAAAAATTGG - Intergenic
1162813769 19:13180960-13180982 CCGCTGCTGGGGAGGATAGATGG + Intergenic
1163409966 19:17148029-17148051 CTGCTGGTGGGAAGGTAAAATGG - Intronic
1163610664 19:18299751-18299773 CAGCTGCTGAGGAGGCTGAAGGG - Intergenic
1164739401 19:30565324-30565346 ATGTTGCAGAGGAGGAAAGATGG + Intronic
1165083184 19:33322971-33322993 CTGCTGGTGGGGATGTAAAATGG + Intergenic
1165142391 19:33707855-33707877 CTGCTGGTGAGAATGTAAAATGG - Intronic
1165278765 19:34779064-34779086 CTGCTGGTGAGAACAAAAAATGG + Intergenic
1165554266 19:36616780-36616802 CTGCAGCTGAGAAGGACAAAAGG - Intronic
1166420883 19:42635081-42635103 CTCCTGCTAAGGAGCAAAAAGGG - Intronic
1166704602 19:44901630-44901652 CTGAGGCTGAGGCGGGAAAATGG + Intronic
1167392392 19:49204356-49204378 CTGCTGGTGAGAATGGAAAATGG - Intronic
1167539589 19:50076827-50076849 ATTATTCTGAGGAGGAAAAAAGG - Intergenic
1167630123 19:50621044-50621066 ATTATTCTGAGGAGGAAAAATGG + Intergenic
1202657560 1_KI270708v1_random:37488-37510 GTGTTTCAGAGGAGGAAAAAAGG + Intergenic
925122791 2:1432419-1432441 CTGCTGCTGAGAATCTAAAAAGG + Intronic
925128727 2:1479430-1479452 CTGCTCCTGAGGAGACAGAAGGG - Intronic
925683861 2:6451646-6451668 CTAATGATGAGGAGGAAGAATGG + Intergenic
926945059 2:18178405-18178427 CAACTGCCGAGGAGGAAAAGGGG - Intronic
927462380 2:23310330-23310352 AGGCTGCTGAGGACGTAAAAGGG - Intergenic
927608482 2:24511376-24511398 CTGCTGCTGGGAATGTAAAATGG - Intronic
928287345 2:30004439-30004461 GTGGGGGTGAGGAGGAAAAAAGG - Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
929640118 2:43569738-43569760 CTGGGCCTGAGGAGCAAAAAAGG + Intronic
929809539 2:45178133-45178155 CTGCTGATGGGAATGAAAAATGG + Intergenic
929920378 2:46167395-46167417 CTGTTGGTGAGGAGGACAACAGG + Intronic
930317760 2:49818054-49818076 CTGAAGATGAGGAGAAAAAAAGG + Intergenic
930991585 2:57662914-57662936 ATTCTGCTGAGGTGGATAAAAGG - Intergenic
931007738 2:57871478-57871500 CCTCTGCTGAGGAGGAGGAATGG + Intergenic
931284148 2:60818528-60818550 TGGCTGCTGAGGGGGAAAGAAGG + Intergenic
932439224 2:71721240-71721262 ATGCTGCTGGGAAGGAAATATGG - Intergenic
932700195 2:73986219-73986241 CTGCTGCAGAGGAGGTGAAGAGG + Intergenic
933114134 2:78445650-78445672 CTGAGGCTGAGGTGGAAGAATGG - Intergenic
933272567 2:80248894-80248916 TTGCTACTGATGAGGAATAAGGG + Intronic
933530956 2:83511176-83511198 CTGCTGCTGATGATGAAGGAGGG + Intergenic
934071322 2:88386477-88386499 TTGCTGCTGAGAATGTAAAATGG + Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
935326331 2:101941167-101941189 GTCCTGCTCAAGAGGAAAAAAGG + Intergenic
935536078 2:104296184-104296206 CAGCTGCAGAAGATGAAAAAAGG - Intergenic
936384383 2:112015268-112015290 CTGCTGGTGAGAATGTAAAATGG - Intronic
936471666 2:112804211-112804233 CTGCTGGTGGGGATGTAAAATGG + Intergenic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
937317871 2:120943519-120943541 CTGTTGCTGATGAAGAGAAAAGG - Intronic
937552452 2:123111357-123111379 TTGCTCCTGAGAATGAAAAATGG + Intergenic
937604888 2:123787688-123787710 TTGCTGCAGAGGTGGAAAGAAGG + Intergenic
937884196 2:126889108-126889130 CTGCTGCAGAGGAGGAGAGGAGG - Intergenic
938081457 2:128372526-128372548 CAGCTCCAGAGGAGGAAAAAGGG - Intergenic
938369800 2:130762037-130762059 CAGCTGCTGTGGAGGAAAGCAGG - Exonic
938684784 2:133727680-133727702 CTGCTGCTGTGGAGTAAGAGAGG - Intergenic
938692673 2:133806777-133806799 ATGCTGCTGAAGAGGGTAAATGG + Intergenic
938962820 2:136358422-136358444 CTGCTGGTGAGAATGGAAAATGG - Intergenic
940198926 2:151128562-151128584 ATATTGCAGAGGAGGAAAAATGG - Intergenic
940373821 2:152932992-152933014 CTGCTGATGAGGAAGTAAATTGG - Intergenic
940433723 2:153625671-153625693 CTGTTGCTGAAGAGAAAAAATGG + Intergenic
940498272 2:154461670-154461692 TTGGCACTGAGGAGGAAAAATGG - Intergenic
940502514 2:154511156-154511178 CTGCTGGTGAGAATGTAAAATGG - Intergenic
940662673 2:156566801-156566823 CTGCTGGTTAGAAGGTAAAATGG - Intronic
940732679 2:157412002-157412024 CTGGTAATGAAGAGGAAAAAGGG - Intergenic
940904253 2:159154459-159154481 CCACTGCTTAGGAGGAGAAAGGG + Intronic
941302847 2:163826114-163826136 ATATTGCTGAAGAGGAAAAAAGG - Intergenic
941576904 2:167244091-167244113 CTGCCTCTGAAGAAGAAAAAGGG + Exonic
941599463 2:167523376-167523398 TTGCTCCTGAGGAGGGGAAATGG - Intergenic
942495127 2:176532143-176532165 TTCCCTCTGAGGAGGAAAAATGG + Intergenic
942918808 2:181345964-181345986 TTGCTGCTGAGAATGCAAAATGG + Intergenic
942942317 2:181632825-181632847 CTGCTCCTCAGGAGGCAGAAAGG + Intronic
943329136 2:186537802-186537824 CTGCTGGTGAGAATGAAAAATGG - Intergenic
943498976 2:188662528-188662550 CTGCTGATGAGAATGTAAAATGG - Intergenic
944174640 2:196816371-196816393 ATGCTGCTGAAAAGGACAAATGG - Intergenic
944319110 2:198315541-198315563 CTGTTGGTGAGGAGAAAAACTGG + Intronic
945281634 2:208040923-208040945 ATGTTGCTAGGGAGGAAAAAAGG - Intergenic
946461308 2:219871275-219871297 AAGCTTCAGAGGAGGAAAAAAGG - Intergenic
946663497 2:222026333-222026355 GTGCTGATGAGGAGGAGAATGGG - Intergenic
946804032 2:223451993-223452015 AAGCTGCAGAGGAGGAATAAGGG + Intergenic
947339593 2:229123621-229123643 CTGCTGGTGGGAAGGTAAAATGG - Intronic
947557951 2:231114153-231114175 CTGCTGCTGACTTAGAAAAAAGG - Intronic
947695770 2:232187298-232187320 CTGCTGGTGAGAATGTAAAATGG + Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948159555 2:235812884-235812906 CTGCTTCTGGGGAGCAAAACGGG - Intronic
1168789169 20:564376-564398 ATGCTGCTGTGGAGGAAGGAGGG + Intergenic
1169339766 20:4787505-4787527 CTGGTGCTGAAGAAGTAAAAGGG + Intronic
1169519382 20:6354757-6354779 CTGTTTCTGAAGAGGAAAAGGGG + Intergenic
1170517575 20:17147936-17147958 CTGCTGCTTATCAGGGAAAAAGG - Intergenic
1170672521 20:18447836-18447858 CTGCTGGTGAGAATGTAAAATGG + Intronic
1170947893 20:20908456-20908478 ATGTTGCTCAGGATGAAAAAGGG - Intergenic
1171488541 20:25500767-25500789 CTGCTGCAGAGGAGGATGGATGG - Intronic
1171964478 20:31518995-31519017 CTGCCTCTGAGGAGGGAAATAGG - Intronic
1171970692 20:31563191-31563213 CTGCTGCTGGGGAGTAACACAGG - Intronic
1172231206 20:33337493-33337515 ATGCTGCTGAGGAGGAGGACGGG + Intergenic
1172933159 20:38600509-38600531 CTCCTCCTGAGGAGGAGACAAGG - Intergenic
1172970438 20:38869511-38869533 CTGCTGGTGAGGATATAAAATGG - Intronic
1173411328 20:42812544-42812566 CTGCTGGTGAGTAGGTAAAATGG + Intronic
1173566168 20:44039982-44040004 CTGCAGCTGATCAGGACAAAAGG + Intronic
1174096558 20:48094127-48094149 CTGTTGGTGAGGATGTAAAAAGG + Intergenic
1174515744 20:51091163-51091185 CAGGTGCTTAGGTGGAAAAATGG - Intergenic
1175034841 20:55990296-55990318 CTTCTCCTGAGAAAGAAAAAGGG + Intergenic
1175360822 20:58411129-58411151 CTGCTGGTGGGAATGAAAAACGG - Intronic
1175519764 20:59593096-59593118 CTGCTGCTGAGAATGCAAAATGG - Intronic
1175659426 20:60799317-60799339 CTGCTGATGGGGATGCAAAATGG + Intergenic
1175673320 20:60925368-60925390 CTGCTGCTGGGAATGTAAAATGG - Intergenic
1175769800 20:61616482-61616504 CTCTTACTGTGGAGGAAAAAAGG - Intronic
1175844425 20:62051164-62051186 CTGGGGCTGAGGAGCAAGAAGGG + Intronic
1176597439 21:8759833-8759855 GTGCTTCAGAGGAGGAAAAAAGG + Intergenic
1176630005 21:9128966-9128988 GTGCTTCAGAGGAGGATAAAAGG - Intergenic
1176643269 21:9325795-9325817 GTGCTTCAGAGGAGGAAAAAAGG + Intergenic
1177221545 21:18200052-18200074 TTGCTGATGGGGATGAAAAATGG - Intronic
1178283914 21:31308927-31308949 CTGATGCAGAGGAGGAAACAGGG + Intronic
1179474314 21:41633495-41633517 CTGCTGGGGAAGAGGAAAGAGGG + Intergenic
1179963179 21:44783304-44783326 CTGCTGCTGGGAATGCAAAATGG + Intronic
1180164241 21:46012957-46012979 CTGCTGATGAGGAGGTTAAATGG - Intergenic
1180369667 22:11973421-11973443 GTGCTTCAGAGGAGGAAAAAAGG - Intergenic
1180376568 22:12098684-12098706 GTGCTTCAGAGGAGGAAAACAGG + Intergenic
1180421002 22:12815001-12815023 GTGCTTCAGAGGAGGAAAAAAGG - Intergenic
1180644308 22:17325966-17325988 CTGCTGCTGCGGATACAAAATGG + Intergenic
1180719023 22:17893171-17893193 CTGATGCTGGGGATGAAGAAGGG - Intronic
1181491065 22:23261049-23261071 CTGCTGGTGAGGAGGATTTAGGG + Exonic
1181713834 22:24709488-24709510 CTGCTGGTGAGGATGCAAAATGG - Intergenic
1181740439 22:24917293-24917315 CTGCTCCTGAGAATGTAAAATGG - Intronic
1182147843 22:28007884-28007906 CTGATTAGGAGGAGGAAAAATGG - Intronic
1182668002 22:31973043-31973065 CTGATGCAGGGGAGGAAGAATGG + Intergenic
1183357263 22:37366522-37366544 CTCCTGCTGATGAAGAAAACAGG + Intergenic
1183963283 22:41425738-41425760 CTGCTGATGAGAATGTAAAATGG - Intergenic
1184539405 22:45110278-45110300 TTGCTGGTGAGAATGAAAAATGG - Intergenic
1184884823 22:47336567-47336589 TTGCTTCTGAGGAGGAAAACGGG - Intergenic
1185363354 22:50422705-50422727 ATGCTGCTGAGCAGGGCAAAGGG - Intronic
949497862 3:4650323-4650345 CTGCTGGTGAGAATAAAAAATGG - Intronic
949933797 3:9101203-9101225 CTGCTGTAGAGGATGATAAAAGG + Intronic
950317039 3:12011608-12011630 ATGCTGCTGAAAAGGAAAGAAGG - Intronic
950625778 3:14245779-14245801 CTGCTGGTGAGAATGTAAAATGG - Intergenic
951630763 3:24717294-24717316 GTGCCCCTGAGGAGTAAAAAGGG + Intergenic
952070972 3:29635476-29635498 CTGGTGGAGAGGAGGAGAAATGG - Intronic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
953152013 3:40333375-40333397 CTACTGCCAGGGAGGAAAAAAGG + Intergenic
953293848 3:41693218-41693240 TTGCTGGTGAGAAAGAAAAATGG + Intronic
953957757 3:47244755-47244777 CAGCTGCTGAGGAGGCAGAGCGG + Intronic
954114806 3:48460565-48460587 CTGCTGCTGGGGAAGGAAACAGG + Exonic
954201269 3:49024745-49024767 CTGGTGCTGTGCAGGACAAAGGG - Exonic
954598188 3:51845569-51845591 CTGCTGGTGGGGTGGAGAAAAGG + Intergenic
954606963 3:51919366-51919388 CTGCTTATGAGAATGAAAAATGG + Intergenic
954770924 3:52967865-52967887 CTGCTGGTGAGAATGTAAAATGG + Intronic
954911983 3:54118269-54118291 TTGCTGATGAGGAAGCAAAATGG - Intergenic
955302842 3:57799656-57799678 TTGCTTCTGTGGAGGAAAATGGG + Intronic
955597880 3:60611561-60611583 CTCATGCTGATGAGGAACAATGG - Intronic
956371107 3:68562751-68562773 ATGAGGCTGAGAAGGAAAAAAGG + Intergenic
956409540 3:68965364-68965386 CAGCTGGTGAGGTGGAAGAATGG + Intergenic
956432208 3:69198477-69198499 CTGCTGCTTGGGATGTAAAATGG + Intronic
956738445 3:72256699-72256721 CTGCTGGTGAGGATGACAACTGG + Intergenic
956948588 3:74253426-74253448 CTAATGGTGAGGAGGACAAAGGG + Intergenic
957096802 3:75784790-75784812 GTGCTTCAGAGGAGGATAAAAGG - Exonic
957645237 3:82913759-82913781 CTGCTGCTGAAAAAAAAAAATGG - Intergenic
957958474 3:87219736-87219758 CTGCTGTTGAAGATGAGAAAGGG + Intergenic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
959049606 3:101512622-101512644 CTGCTGCTGGGGAGGAAAGGTGG - Intronic
959094439 3:101938395-101938417 CTTGTGCTGAGGTAGAAAAAAGG - Intergenic
960509613 3:118532585-118532607 CTGCTGGTGAGAATGTAAAATGG - Intergenic
961015215 3:123462832-123462854 CTGCTGGTGAGAATGCAAAATGG + Intergenic
961758675 3:129148384-129148406 CTGCTAGTGAGGAGGCAAAATGG - Intronic
962247476 3:133808226-133808248 CTGCTTCTGAGGAGAAAACTAGG - Intronic
962594426 3:136925932-136925954 CTGCTGATGAGAATGTAAAATGG - Intronic
962648945 3:137468452-137468474 CTACTACTGAGGAGGAAGGAGGG + Intergenic
962938676 3:140105789-140105811 CATATGCTGAGGAGGAAAACAGG - Intronic
963656136 3:148053293-148053315 CTGCTGGTGAGAATGCAAAATGG + Intergenic
963694161 3:148543657-148543679 CTGCTGGTAAGGATGTAAAATGG - Intergenic
964176722 3:153832491-153832513 CTGCTTCTGGGGAGGCACAAGGG + Intergenic
964848566 3:161069665-161069687 CTGCTACTGAGCAGAAAACATGG - Exonic
964899431 3:161640322-161640344 TTGCAGCTGAGGAAGGAAAAGGG - Intergenic
965475028 3:169146588-169146610 CTGCGGGCGAGGAGGAAAGAAGG + Intronic
965653113 3:170953902-170953924 CTGCTGCTGCCGAGCAAAACCGG + Intergenic
966853649 3:184179447-184179469 CAGCTGCTGAGATGGAAAACTGG - Intronic
967737781 3:192971642-192971664 CTGCTGGTGAGAATGTAAAATGG - Intergenic
968091610 3:195901517-195901539 CAGCTGCTGAGGAGGAAGAGAGG + Intronic
1202743615 3_GL000221v1_random:79234-79256 GTGCTTCAGAGGAGGAAAAAAGG - Intergenic
968430282 4:554402-554424 CTGCTGTTGACGGGGAAAACAGG - Intergenic
969570226 4:8004049-8004071 CAGCTCCAGAGGAGTAAAAAGGG + Intronic
969582237 4:8072137-8072159 CCTCTGCTGTGGAGGAGAAAGGG - Intronic
970200403 4:13599229-13599251 CTGCTGCTCAGCAGGAAGAAAGG + Exonic
970879565 4:20912921-20912943 CTGCTGGTGAGAATGGAAAATGG + Intronic
971310971 4:25525504-25525526 CTGGAGCTGAGGAGGAGAGAGGG - Intergenic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
971991681 4:33906053-33906075 ATGAAGCTGTGGAGGAAAAAGGG + Intergenic
972734071 4:41823220-41823242 CTGAAGGTAAGGAGGAAAAAAGG + Intergenic
972973975 4:44610627-44610649 CTGCTGCTTATGAGGAATGATGG + Intergenic
973360739 4:49162052-49162074 GTGCTTCAGAGGAGGAAAAAAGG + Intergenic
973689669 4:53413227-53413249 CTGCTTCTAAGGAAGAAACAGGG - Intronic
973804436 4:54512197-54512219 TTGGTGTTCAGGAGGAAAAAAGG + Intergenic
975562678 4:75722242-75722264 ATGCTGCTGGGGAAGAAAACAGG + Intronic
975675823 4:76826441-76826463 CTGCCCATGAGGAGGAAAAAAGG + Intergenic
975736177 4:77383301-77383323 CTACAGTTGAGAAGGAAAAATGG - Intronic
975814274 4:78201739-78201761 ATGTCGCTGATGAGGAAAAAAGG + Intronic
976397692 4:84573957-84573979 CTGCTGATGTGGAGGAAGAGTGG - Intergenic
977297037 4:95222042-95222064 TTGCTGCTGAAGAGAAGAAAGGG - Intronic
978779194 4:112532232-112532254 TTGCTTCTGAGGAGGAAACCTGG + Intergenic
979038923 4:115762214-115762236 ATTCTGCTGAGTAGTAAAAAAGG + Intergenic
979166560 4:117539850-117539872 CAGCTGCTGTGCAGGAGAAAAGG + Intergenic
979582821 4:122379825-122379847 CTGCTACAAAGGAGGAAAGAAGG - Intronic
979749542 4:124261227-124261249 CTGCTGGTGGGGATGAAAAGTGG + Intergenic
980061201 4:128131949-128131971 CTGCTGCTGGGAATGTAAAATGG + Intronic
980451607 4:132980581-132980603 CTGCTGCAGAGGGAGAAAAGCGG + Intergenic
980936480 4:139230576-139230598 ATGCTGCTGTGGAGGAAACTGGG + Intergenic
981214461 4:142148126-142148148 CTGCTACTGAGGAAAAAAAGGGG + Intronic
981721059 4:147801824-147801846 CTGCTGCAGAGATGGAGAAATGG + Intronic
982520579 4:156411748-156411770 CTGCTGCTCAGGAAAAAAAAAGG - Intergenic
982799247 4:159683084-159683106 TTGCTGGTGAAGATGAAAAATGG + Intergenic
983612896 4:169669726-169669748 TTGCTGGGGAGGAGAAAAAAGGG - Intronic
983729800 4:170979068-170979090 CTGCTTCTGTGGAGGTAACAGGG + Intergenic
983803193 4:171961740-171961762 CTGCTGCTCAGAAGAAACAAGGG + Intronic
984102559 4:175502714-175502736 CAGATGTTGAGGAGGAAAAGAGG - Intergenic
984250386 4:177325655-177325677 CTGCTGGTGAGAATGTAAAATGG - Intronic
984582736 4:181529202-181529224 GTACTGCTGGGGAGGAATAAGGG - Intergenic
984988494 4:185354354-185354376 CTACTGCTCAAGAGGAAAAAAGG - Intronic
1202758171 4_GL000008v2_random:84117-84139 GTGCTTCAGAGGAGGAAAAAAGG + Intergenic
985921286 5:2978104-2978126 AAGCTACTAAGGAGGAAAAAAGG - Intergenic
985972092 5:3386379-3386401 CTGCTGCTGGGGGAGAAAAGGGG + Intergenic
985973253 5:3393690-3393712 ATGATGCTGAGAAGGATAAAAGG - Intergenic
986033202 5:3912279-3912301 CTGCAAATGAGGAGGTAAAATGG - Intergenic
986048677 5:4066164-4066186 CAGCTACTGATGAGAAAAAATGG + Intergenic
987693789 5:21302143-21302165 CTGCTTCTGGGGAGGCTAAAGGG + Intergenic
988829645 5:34974990-34975012 CTGCTGGTGAGAATGTAAAATGG - Intergenic
989358579 5:40573203-40573225 CTGCTGATGTGGAGGAGAGAAGG - Intergenic
990379618 5:55209771-55209793 CTGCTGGTGAGAATGTAAAATGG + Intergenic
991155110 5:63424993-63425015 ATGCTGATAAGGAGGAAAAGAGG - Intergenic
991746468 5:69747396-69747418 CTGCTTCTGGGGAGGCTAAAGGG - Intergenic
991751237 5:69807845-69807867 CTGCTTCTGGGGAGGCTAAAGGG + Intergenic
991798069 5:70327341-70327363 CTGCTTCTGGGGAGGCTAAAGGG - Intergenic
991825846 5:70622710-70622732 CTGCTTCTGGGGAGGCTAAAGGG - Intergenic
991830525 5:70682739-70682761 CTGCTTCTGGGGAGGCTAAAGGG + Intergenic
991890409 5:71326663-71326685 CTGCTTCTGGGGAGGCGAAAGGG - Intergenic
992116260 5:73540987-73541009 CTGGTGCTCAGGTGGCAAAATGG + Intergenic
992131991 5:73702637-73702659 CTGCTGCTGAAAATGTAAAATGG - Intronic
992393233 5:76348530-76348552 CTGCTGGTGAGAATGCAAAATGG - Intronic
993097827 5:83500910-83500932 CTGCTGATGAGAATGTAAAATGG - Intronic
993783916 5:92105047-92105069 TAGCTGGTGAGGAGGCAAAAAGG + Intergenic
994708777 5:103240271-103240293 CTGCTGGTGGGGATGTAAAATGG + Intergenic
995963141 5:117869931-117869953 TTGCTGATAAGGATGAAAAATGG + Intergenic
996144786 5:119960899-119960921 ATACTGGTGAGGAGGAGAAAGGG + Intergenic
996227902 5:121023642-121023664 CTGCTGCAGAGCAGGAACTAGGG - Intergenic
997292836 5:132749724-132749746 CTGCTGTTGAGCAAGGAAAAAGG + Intronic
997295449 5:132765856-132765878 CTCCTCCTGAGTAGGAAAACAGG - Intronic
997515712 5:134488143-134488165 CTGCTGATGAGAACGCAAAATGG - Intergenic
998031342 5:138871546-138871568 CTGCTGCTGAAAAGGGAAGAGGG - Exonic
998068672 5:139179508-139179530 CTGCTTCTGTAGAGGGAAAATGG - Intronic
998113373 5:139518718-139518740 CAGAGGCTGAGGAGGAAGAATGG - Intergenic
998180864 5:139940017-139940039 CTGCTGCTGGGAAGGTCAAATGG + Intronic
998774898 5:145588307-145588329 GTGCTGCTCAGGAGGAATTAGGG - Intronic
999145825 5:149393082-149393104 TTGCTGCTGAGGAAGGAAAGGGG - Intronic
999700902 5:154227251-154227273 CTGCTGCTGGGAATGTAAAATGG - Intronic
999945686 5:156592698-156592720 CTGCAGATGAGGAGAACAAATGG - Intronic
999947786 5:156616169-156616191 CTGCTGGTGAGCAGAAAAAGTGG + Intronic
1000280976 5:159781842-159781864 CTGGTGCTGAGAAAGAAACAGGG + Intergenic
1000305678 5:159992283-159992305 CTGCTGATGGGGATGTAAAATGG + Intergenic
1000394246 5:160756471-160756493 CTGCTGCTGGGAATGCAAAATGG - Intronic
1000632105 5:163602405-163602427 ATGCTCCTGAGAAGGAAGAATGG - Intergenic
1000652899 5:163838818-163838840 CTACTGCTGAGAAAGCAAAATGG - Intergenic
1001046878 5:168380567-168380589 CTGCTGGTGAGAATGTAAAATGG + Intronic
1001050427 5:168409588-168409610 CAGTTGGTGAGGAGGAAACAGGG - Intronic
1001352600 5:170983889-170983911 CTGCTGAAGAGGAAGGAAAATGG + Intronic
1001634927 5:173202998-173203020 CTGCTGGAGAGGAGGGAGAAGGG - Intergenic
1002213020 5:177609523-177609545 CTGCTCCTGGGGAGGAAGAGAGG - Exonic
1002536141 5:179876741-179876763 CAGCTGCTGGGGAGGAAGTATGG + Intronic
1004461338 6:15839788-15839810 CTGCTGGTGGGGAGGCAAAATGG - Intergenic
1004534716 6:16489518-16489540 CTGCTGGTGATGAGGAAATGGGG - Intronic
1004616575 6:17296105-17296127 CTGCTGCAGATCAGGAAGAAAGG - Intergenic
1005083759 6:21982705-21982727 TTGCTGGTGAGAAGGTAAAAGGG - Intergenic
1005150216 6:22740490-22740512 CTGCTGCTGAGGACAAAAGGTGG + Intergenic
1005266140 6:24114043-24114065 CTACTGTTAAGGGGGAAAAAAGG + Intergenic
1005268756 6:24140904-24140926 CTGCTGCTGGAAAGGAAAATTGG - Intronic
1005379854 6:25222782-25222804 TTGCTCTAGAGGAGGAAAAATGG - Intergenic
1005497451 6:26400568-26400590 AAACTGCTGGGGAGGAAAAAGGG + Intergenic
1005562815 6:27058643-27058665 GAGGTGTTGAGGAGGAAAAAGGG + Intergenic
1006528309 6:34627464-34627486 CTGCTGGTGAGAATGCAAAATGG - Intronic
1006897612 6:37480934-37480956 CTGCTGCTGTGGGGGAAAGACGG - Exonic
1006973152 6:38067997-38068019 CTGCTGCTAGGGAGGATTAATGG + Intronic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1007318002 6:41004833-41004855 ATCCAGCTGAAGAGGAAAAATGG - Intergenic
1007977291 6:46114450-46114472 ATGCTGATAAGGAGGAAAGAGGG - Intergenic
1009424023 6:63494282-63494304 CTGCTGCTTTGGAGTAAATATGG - Intergenic
1009791248 6:68403893-68403915 CTGAGGCCTAGGAGGAAAAATGG - Intergenic
1009996122 6:70897008-70897030 CTGCTGATGAGAATGTAAAATGG - Intronic
1010619052 6:78051680-78051702 CTGCTGATGGGAAGGCAAAATGG - Intergenic
1010944864 6:81961887-81961909 CTGCTGGTAAGGATGTAAAATGG + Intergenic
1011206045 6:84899470-84899492 CTGCTGCTGAGAATGCAAAATGG - Intergenic
1011870424 6:91886085-91886107 CTGAGGCTTAGGAGGAAAAATGG + Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1012276775 6:97283408-97283430 CTGCTGCTGAGGCGGAGGAGAGG + Intergenic
1012614284 6:101257378-101257400 CTGCTGGTGAGAATGAAAAATGG + Intergenic
1012892791 6:104915983-104916005 CTGCTGAGGATGAGGAGAAAAGG + Intergenic
1012913001 6:105137690-105137712 CTCCTGCTGCGGAGGAAGAGGGG + Intergenic
1012960110 6:105613661-105613683 CTGATTCTGAGGTGGGAAAATGG + Intergenic
1013177776 6:107691806-107691828 CTGCAGCTGATGATGAAAAAAGG + Intergenic
1013209370 6:107973084-107973106 CTAATACTAAGGAGGAAAAAAGG + Intergenic
1014211238 6:118710428-118710450 CGGCTGCTAAGAAGCAAAAATGG + Intergenic
1014792215 6:125686057-125686079 ATGCAACTGGGGAGGAAAAATGG - Intergenic
1014816578 6:125942313-125942335 CTTCTGGTGAGGAAGACAAACGG + Intergenic
1015100234 6:129469488-129469510 CTGCTGCTGAGGATATAAAGTGG + Intronic
1015741471 6:136459300-136459322 CTGTTACTGAGAATGAAAAATGG + Intronic
1015958265 6:138620946-138620968 CTGCAGCTGGGGAGGACAGATGG + Intronic
1016180779 6:141145557-141145579 ATGATGCAGAGGAGGAGAAAAGG - Intergenic
1016376363 6:143424641-143424663 CTTTTGCTGAGGAGGAAATTAGG + Intronic
1016819799 6:148336495-148336517 CTGCTGCTAAAGAGGTAAATGGG + Intronic
1016848252 6:148590657-148590679 CTGGTGGGGAGGAGGAAATAAGG + Intergenic
1017727948 6:157288554-157288576 CTGCTCCAGAGTAGGAAACATGG + Intergenic
1017737870 6:157380746-157380768 CAGCTGGGGAGGAGGAAGAAGGG + Intergenic
1017945175 6:159090761-159090783 CTGCAGCTGAGGCGGTAAGACGG - Intergenic
1018070759 6:160162303-160162325 ATGCTGCTGAGCAGGACAGAGGG + Intergenic
1018247919 6:161840075-161840097 CTTCTGCTGAGGAACAAACAAGG + Intronic
1018513713 6:164555133-164555155 CTGCTGCTTAGTAGGAAGGAGGG + Intergenic
1019052366 6:169192898-169192920 CTGCTGCTGAGGAGAGAATTGGG - Intergenic
1019266360 7:119489-119511 CCGCTGCTGACGAGGAAGCAGGG + Intergenic
1019584194 7:1787876-1787898 CAGGTGCTGTAGAGGAAAAAGGG - Intergenic
1019655127 7:2189214-2189236 CTGCTGATGAGAACGTAAAATGG + Intronic
1021546135 7:21815058-21815080 CCCCTACTGAGCAGGAAAAAAGG + Intronic
1022209181 7:28191956-28191978 CAGAGGCTGGGGAGGAAAAAGGG + Intergenic
1022355062 7:29606897-29606919 CTGCAGAAGAGGAGAAAAAAGGG - Intergenic
1023003220 7:35834046-35834068 CTGCTGCTGTGGAGTAGAGATGG + Intronic
1023311772 7:38894843-38894865 CAGCTGATGAGGAGGAGAAAGGG - Intronic
1023369899 7:39502725-39502747 GTGCTGTTGAGGTGGAAAGAAGG - Intergenic
1023760141 7:43457919-43457941 CGGCTGCTGATGGGGAAAAGTGG - Intronic
1023880269 7:44314691-44314713 TTGCTGGTGAGGATGTAAAATGG - Intronic
1024089850 7:45926623-45926645 CTGCAGATGAGGATGTAAAATGG - Intergenic
1024865514 7:53901077-53901099 CTGCGGCTGAGGATGAAAGGCGG - Intergenic
1024869343 7:53943782-53943804 CTGCTGATGGGAAGGCAAAATGG - Intergenic
1024944544 7:54795427-54795449 TATCTGCTGAGGAGGAAAAGAGG - Intergenic
1026157457 7:67839412-67839434 CTGCTGATGAGGGTGTAAAATGG - Intergenic
1026499454 7:70930986-70931008 TTGCTGCTGAGAATGCAAAATGG - Intergenic
1028074504 7:86494905-86494927 CTGCAGGTGATGAGGAAGAATGG - Intergenic
1028402803 7:90442594-90442616 CTCCTCCTGAGGAGGAAGTAAGG - Intronic
1028430092 7:90736447-90736469 CTGCTGCAGGGGATGTAAAATGG - Intronic
1029433094 7:100544875-100544897 TTGCTGCTGAGGAGGAACAAAGG + Intronic
1029954460 7:104622907-104622929 CTGCTGCTGGGAATGTAAAATGG - Intronic
1030135829 7:106247026-106247048 CTGCTGCTAACCATGAAAAATGG + Intergenic
1032003087 7:128278341-128278363 TTGCTGCTGAGGATGCAAAATGG + Intergenic
1032074073 7:128828028-128828050 GAGCTGCTGGGGAGGAGAAAGGG - Intergenic
1033057572 7:138073317-138073339 TTGCTACTGGGGAGGCAAAATGG + Intronic
1033632194 7:143169732-143169754 CTGTTGTTGAGAAGGTAAAATGG + Intergenic
1033887148 7:145963052-145963074 CTGCTGCTGCTGGGGAATAAGGG - Intergenic
1035304470 7:157922638-157922660 CTTTTGCTGGGAAGGAAAAAGGG + Intronic
1035567788 8:652991-653013 CTGTTGCTGGGAATGAAAAACGG + Intronic
1036099795 8:5767121-5767143 CTGCTGCTGGGGATGCAAAATGG - Intergenic
1036218918 8:6904074-6904096 CTGTTGCTGTGGAGGTCAAATGG + Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037168160 8:15856555-15856577 CTGCTGCTTTGGAGAAAATATGG + Intergenic
1037458622 8:19086916-19086938 CTGTACCTGAGGAGGAAAGAAGG + Intergenic
1037563446 8:20095730-20095752 TTGCTGGTGAGGAGGTAAATGGG - Intergenic
1037777211 8:21843390-21843412 TTGCTGCTGAGGAGTAAGCAGGG + Intergenic
1038313054 8:26460367-26460389 CTGCTGGTGAGAATGTAAAAGGG + Intronic
1038324033 8:26557984-26558006 TTGCTGGTGAGGATGCAAAATGG + Intronic
1040508954 8:48076601-48076623 CTGCTGGTGAGGATGTGAAATGG - Intergenic
1040710277 8:50179822-50179844 CTGCTGCTGAGAATGTAAATTGG + Intronic
1041012121 8:53555260-53555282 CTGCTGATGAGAATGTAAAATGG + Intergenic
1041102663 8:54412308-54412330 CTGCAGGTGAGGAGGAAGCATGG - Intergenic
1041127811 8:54662724-54662746 GGACTGCGGAGGAGGAAAAATGG + Intergenic
1042521490 8:69716420-69716442 CTGCTGCTGAGAATGTGAAATGG - Intronic
1042724254 8:71855718-71855740 TTGCTGCTGAGAATGTAAAATGG - Intronic
1043842235 8:85121035-85121057 CTGCTGCTGAAGATGTAAAATGG - Intronic
1044281873 8:90365941-90365963 CAGATGCTGTGGAGGAAAAATGG - Intergenic
1044301006 8:90582806-90582828 CAGCTGTTGATGAGGGAAAAAGG - Intergenic
1044756114 8:95462968-95462990 CTGCTGCTGGGAAGGCAATATGG - Intergenic
1045043434 8:98249959-98249981 CTGCTTCTGGAAAGGAAAAATGG + Intronic
1045193736 8:99908866-99908888 CTGTTGCTGAAGAAGAAATAGGG + Intergenic
1045262884 8:100592514-100592536 CTGCTGCTGGGGATATAAAATGG + Intronic
1046320021 8:112560994-112561016 TTGCTGGTGATGAGGTAAAATGG + Intronic
1047349810 8:124062917-124062939 CTGCTGAAGAGGAGAAAAATGGG - Intronic
1047697953 8:127421847-127421869 ATGCTTATGAGGTGGAAAAAAGG - Intergenic
1048018372 8:130517382-130517404 CTGCTCTTGAGCAGGAAAAGTGG + Intergenic
1049099401 8:140568427-140568449 CTGCTGCTGAGGAGGGAGCGAGG + Intronic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049611796 8:143559315-143559337 ATGCTCCTGAGGAGGGGAAATGG - Exonic
1049815528 8:144597423-144597445 CTGCAGCTGGGGAGGAACACAGG + Intronic
1050926697 9:11272863-11272885 CTGCTGATGATGTGGAGAAAAGG - Intergenic
1051124381 9:13787573-13787595 CTGCTGCTGAGGATTCAAAGAGG + Intergenic
1051798230 9:20900286-20900308 CTAATGCTGAGGCGGAAATATGG - Intronic
1052539515 9:29790803-29790825 TTGCTGGTGAGGAAGGAAAATGG + Intergenic
1052616779 9:30851887-30851909 CTGCTGATGGGGTGGAAAAGAGG - Intergenic
1052627667 9:30998633-30998655 CTGTTGCTGGGAAAGAAAAATGG + Intergenic
1053206268 9:36188953-36188975 CTGCTGCTTAGGAGGTTAATCGG - Intergenic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1055983159 9:82026269-82026291 CTGCTGGTGGGAATGAAAAATGG - Intergenic
1056606224 9:88087768-88087790 CTGCTGCTGGGAAGGCAAAGTGG - Intergenic
1057076269 9:92139756-92139778 CTGCTGCTGAGGTTGCAACAGGG + Intergenic
1057269166 9:93637881-93637903 CTGCTGGTGGGAAGGTAAAACGG - Intronic
1057455781 9:95208781-95208803 CTGCTGATGGGGATGAAAAATGG + Intronic
1057637459 9:96783209-96783231 CTGCTGGTGGGAAGGTAAAATGG - Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1059003815 9:110379672-110379694 CTGCTGCTGTTGAGAAAAATTGG + Intronic
1059509377 9:114829862-114829884 CTTCTGCAGAGAAGGAAAAGTGG + Intergenic
1059651291 9:116318659-116318681 TTGCTGCAGAGGAGGAACACGGG - Intronic
1059756667 9:117300254-117300276 CTGCTGCTTAGAGGGAACAAAGG - Intronic
1060529121 9:124337840-124337862 TTGCTGATGAGAAGGTAAAATGG - Intronic
1060698953 9:125734098-125734120 CTGCTGGTGGGAATGAAAAATGG + Intergenic
1060860309 9:126948631-126948653 CTGAAGCTGAGGAGGCAGAAGGG - Intronic
1060955908 9:127639511-127639533 CTGCTGGTGAGAATGTAAAATGG - Intronic
1061249181 9:129416517-129416539 CGGCTACTGAGCAGGAACAAAGG - Intergenic
1061440694 9:130601384-130601406 ATGCTCCTGAGGAAGAAAACTGG - Intronic
1061541906 9:131282036-131282058 CTGCTGCTGAGCTGGAGGAAGGG + Intergenic
1061567228 9:131449295-131449317 CTGCTGCTGGGAATGTAAAATGG - Intronic
1061717534 9:132529892-132529914 CTGCTGGTGAGGATGGAAAATGG - Intronic
1062523642 9:136969721-136969743 CCGCTGCTGAGGAGGGAGAGGGG + Intronic
1203689778 Un_GL000214v1:31137-31159 GTGCTTCAGAGGAGGAAAAAAGG + Intergenic
1203752840 Un_GL000218v1:96651-96673 GTGCTTCAGAGGAGGATAAAAGG - Intergenic
1203442031 Un_GL000219v1:17971-17993 CTGTTGCTGAGGATGTCAAATGG + Intergenic
1203512839 Un_KI270741v1:136880-136902 CTGTTGCTGAGGATGTCAAATGG + Intergenic
1203712250 Un_KI270742v1:109198-109220 GTGCTTCAGAGGAGGAAAAAAGG - Intergenic
1203538960 Un_KI270743v1:68989-69011 GTGCTTCAGAGGAGGAAAAAAGG + Intergenic
1203555855 Un_KI270743v1:207524-207546 GTGCTTCAGAGGAGGAAAAAAGG - Intergenic
1203646497 Un_KI270751v1:72916-72938 GTGCTTCAGAGGAGGAAAAAAGG - Intergenic
1185967106 X:4619083-4619105 ATGCAGCTGAGGAGAAAAGAAGG + Intergenic
1186652998 X:11581323-11581345 CTGCTGGTGGGGATGTAAAATGG + Intronic
1187284576 X:17892494-17892516 CTACTGGTGGGGATGAAAAATGG + Intergenic
1187586151 X:20663954-20663976 CTGCTGGTGGGGATGTAAAATGG + Intergenic
1188222489 X:27558261-27558283 CTGATCCTGAGGAGGAAGTAAGG - Intergenic
1188495359 X:30777865-30777887 CTGCTGCTGGGGAGGCCACAGGG - Intergenic
1189775419 X:44466113-44466135 TTGCTGATGAGGATGTAAAATGG - Intergenic
1190382198 X:49850208-49850230 CTGCTGATGAGAATGCAAAATGG + Intergenic
1190547068 X:51538647-51538669 TTGCTGGTGGGAAGGAAAAATGG - Intergenic
1190551832 X:51590798-51590820 TTGCTGGTGGGAAGGAAAAATGG + Intergenic
1190704607 X:53016549-53016571 CTGCTGGTGAGAATGTAAAATGG + Intergenic
1191765817 X:64697268-64697290 CTGCAACTGAGGATGAGAAAGGG + Intergenic
1193425673 X:81338089-81338111 GAGGTGCTGAGCAGGAAAAATGG + Intergenic
1193891849 X:87057186-87057208 CTGCTGCTGAGAATGTAAAATGG + Intergenic
1194431932 X:93819026-93819048 CTGGTGATGATGAGGAGAAAAGG + Intergenic
1194536258 X:95108532-95108554 CTGATGATGAGGAGGAAGGAGGG - Intergenic
1195266553 X:103186376-103186398 CTGCTGGTGAGAATAAAAAATGG - Intergenic
1195387981 X:104331316-104331338 CTACTGCTGAAGAGGAATAGAGG - Intergenic
1195432311 X:104803082-104803104 CTGCTGTTGGGGAGGAAGAAAGG + Intronic
1196157037 X:112441575-112441597 CTGCTGGTGAGAATGCAAAAGGG + Intergenic
1196417125 X:115483133-115483155 CTGCTGGTGAGAATGGAAAATGG + Intergenic
1196435189 X:115667788-115667810 CGGGTGCTGAGGATGAAATAGGG + Intergenic
1196646383 X:118122264-118122286 CTGCTACTGTGAATGAAAAATGG + Intergenic
1196796167 X:119503502-119503524 CTACTGCTGAAAAGGAAATAGGG + Intergenic
1197161359 X:123326344-123326366 CAGCCACTGGGGAGGAAAAAAGG - Intronic
1197359737 X:125485694-125485716 GTGCTGCTGAGGAGTGAAGATGG - Intergenic
1197879425 X:131149985-131150007 CTGCAGGTGAGAATGAAAAATGG - Intergenic
1197899100 X:131349752-131349774 CTGCTGCTGTGGATGCAAAATGG + Intronic
1198370718 X:135986061-135986083 CTGGGGGTGCGGAGGAAAAAGGG - Intronic
1198521545 X:137458409-137458431 CTGCTGATGGGGAAGTAAAATGG - Intergenic
1198619615 X:138491672-138491694 CTGCTTCAGAGGAAGAAGAAAGG - Intergenic
1199169651 X:144721178-144721200 CTGCAGCTCAGAAGGAAAAAAGG + Intergenic
1200018566 X:153183012-153183034 ATGCTCCTGAGGAGGAAATCTGG + Exonic
1200082299 X:153583856-153583878 CTGCTGATGAGAATGGAAAATGG - Intergenic
1200362111 X:155618181-155618203 CAGGTGTTGAGGAGGAGAAAGGG - Intronic
1200393521 X:155968538-155968560 CAACTGCTCAGGAGGAAACAGGG - Intergenic
1201166481 Y:11214221-11214243 GTGCTTCAGAGGAGGATAAAAGG - Intergenic