ID: 1117026624

View in Genome Browser
Species Human (GRCh38)
Location 14:51627223-51627245
Sequence TAGGGAAGTTTGGCTAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117026624 Original CRISPR TAGGGAAGTTTGGCTAGTGC AGG (reversed) Intronic
904747192 1:32718539-32718561 TGGGGAAGTCTGGCTAGAGCAGG + Intergenic
908251423 1:62268898-62268920 TGGGGATGTTTGGCTAGAGTTGG - Intronic
908458535 1:64327338-64327360 TAGGGAAGTTTGGATCCAGCTGG + Intergenic
915490853 1:156249371-156249393 TTGGGAAGCTAGGCTAGTACTGG + Exonic
915988586 1:160490784-160490806 TAGGTAAGTTTGTCTATAGCCGG + Intronic
916867164 1:168872632-168872654 TAGGGAAGTTTGTACATTGCTGG + Intergenic
917108927 1:171524918-171524940 TAGGGAACTTTTGCTACTGATGG - Exonic
920556833 1:206910071-206910093 TAGGGAAGTTAGGGAAGTGGGGG - Intronic
1066287525 10:33982573-33982595 GAGAGGAGTTTGGCTAGTGGTGG - Intergenic
1069745724 10:70713641-70713663 TAGGGAAGACTGGCTAGGGTGGG + Intronic
1076410606 10:130246306-130246328 TAGGGATGTTAGGATAGAGCAGG + Intergenic
1077074141 11:692533-692555 TAGGGCAGTTTGGTGAGTGCTGG - Intronic
1078896452 11:15601208-15601230 TAATGAAGTTTGGGCAGTGCTGG + Intergenic
1085300625 11:75456249-75456271 TAGGGAAGTTTGGGTCATCCTGG + Intronic
1088678808 11:112221942-112221964 TTGGGAAGCTAGGCTAGTACTGG + Intronic
1088932302 11:114364514-114364536 TAGGTAAGTCTGTCTAGTTCTGG - Intergenic
1089257024 11:117199456-117199478 GAGGGAAGTTGGGCTGGAGCTGG + Intronic
1089259957 11:117217503-117217525 GAGGGAAATTGGGCAAGTGCTGG + Intronic
1090869090 11:130726920-130726942 GAGAGCAGTTTGGCAAGTGCAGG + Intergenic
1091382166 12:68791-68813 TAGAGAAGTTGGGTTAGGGCAGG + Intronic
1093135624 12:15446875-15446897 TAGGGAAGCTTGGAAAGAGCTGG + Intronic
1093914219 12:24782861-24782883 GAGGGAAGTTTGGATAGACCAGG - Intergenic
1095527768 12:43148489-43148511 TAGGGAAGTTTGGAGAGATCAGG - Intergenic
1096072179 12:48781571-48781593 CAGGGAGGTTTGGGGAGTGCTGG - Intronic
1096936872 12:55289937-55289959 TAGGAAACTTTTGGTAGTGCTGG - Intergenic
1097269905 12:57767547-57767569 GGGGGAGGTGTGGCTAGTGCAGG - Intronic
1104055297 12:125225456-125225478 TAGGCAAGTTTTGCTAGAGGTGG + Intronic
1106456168 13:29929243-29929265 TAGGGAAGTCAGGCTAAGGCAGG - Intergenic
1110279735 13:73679072-73679094 TACGGATGTTTGACTATTGCTGG + Intergenic
1111837658 13:93408803-93408825 TAGTGATGTCTGCCTAGTGCAGG + Intronic
1114216208 14:20659599-20659621 CAGCCAAGTTTGGCTACTGCTGG - Intergenic
1117026624 14:51627223-51627245 TAGGGAAGTTTGGCTAGTGCAGG - Intronic
1118085667 14:62413378-62413400 TGGGGAAGTCTGGCTTCTGCTGG + Intergenic
1118849095 14:69571236-69571258 TAGGGAAGTTTGGCAAGGGTCGG + Exonic
1119654246 14:76405647-76405669 AAGGGTAGTTTGGCTACAGCAGG - Intronic
1120155813 14:81092094-81092116 TGGCGAAGTTTGGCAAGTGAAGG + Intronic
1121690575 14:95875338-95875360 CAGGGAAGTAAGGCAAGTGCCGG - Intergenic
1122509050 14:102250952-102250974 TAGGGGACTTTGGCTCCTGCCGG - Exonic
1124330221 15:28806227-28806249 TATGGATGGTGGGCTAGTGCTGG + Intergenic
1128061167 15:64736836-64736858 GAGGGAAGTAGGGCAAGTGCCGG - Intergenic
1129452602 15:75659296-75659318 CAGGGAAGGTTGGCTAGACCAGG + Exonic
1129550035 15:76438629-76438651 AAGGGAGATTTGCCTAGTGCAGG - Intronic
1131993530 15:98112942-98112964 TGGGGATGGGTGGCTAGTGCAGG + Intergenic
1132602847 16:781683-781705 CAGGCAAGTTTGGCTAGAGGGGG - Intronic
1134329646 16:13238754-13238776 GAGGGAAGTTTGGATAGGGAAGG + Exonic
1134891978 16:17848935-17848957 TGGGGGAGGTAGGCTAGTGCTGG - Intergenic
1135069461 16:19339390-19339412 TAGTGGACTTTGGGTAGTGCTGG + Intergenic
1147870049 17:43580914-43580936 TAGGGATCATTGGCTAGTGTAGG + Intergenic
1148814485 17:50317594-50317616 TAGGGAAGATTGGCTGCTGATGG + Intergenic
1149717587 17:58808266-58808288 CAGGGATGTTTGGCTATTTCTGG + Intronic
1152123257 17:78431730-78431752 GAGGGAAGGTTGGCCAGCGCAGG + Intronic
1154062826 18:11079487-11079509 TAGGGGAGTTTGGCTAGAATTGG - Intronic
1154210575 18:12376115-12376137 AAGGGGAGATAGGCTAGTGCCGG - Intronic
1156265474 18:35484330-35484352 TAGAGAGGTGTGGGTAGTGCAGG + Intronic
1168520393 19:57045761-57045783 TAGGGAAGTTGGGTTGGTGTGGG - Intergenic
932533596 2:72566144-72566166 TAGGGAATTTTGGGAAGTGCTGG - Intronic
939881156 2:147632844-147632866 AAGGGAAGTTTGCTCAGTGCGGG - Intergenic
1170621299 20:17998606-17998628 CAGAGAAATTTGGTTAGTGCTGG + Intronic
1176283034 20:64326042-64326064 TAGAGAAGTTGGGTTAGGGCAGG - Intergenic
1179209959 21:39315889-39315911 TAGGGAAGTTTGGGTTATCCAGG + Intronic
954458792 3:50614283-50614305 TATGGAAATTTGGCTAGTGAGGG - Intronic
957661791 3:83165492-83165514 TTGAGAAGTTTTGCTAGAGCTGG + Intergenic
960373872 3:116874624-116874646 TCTGGAAGTTTGGCTAATGAGGG + Intronic
964537399 3:157738869-157738891 GAGGGAAGTTGGGTCAGTGCCGG - Intergenic
966623085 3:181986712-181986734 TGGTGAAGTTTGTCTAGTGTTGG + Intergenic
967551040 3:190796362-190796384 TAGGGAAGTCAAGCGAGTGCTGG + Intergenic
975368819 4:73560100-73560122 TTGGGAAGTTTGAAAAGTGCTGG + Intergenic
975773311 4:77754598-77754620 TAAAGAATTTTGGCTAGTTCTGG - Intronic
979025679 4:115571355-115571377 TCAGGAAGTGTGGCTAGTGAGGG + Intergenic
979353434 4:119673515-119673537 TAAGTAAGTTTGGGAAGTGCTGG + Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
987066614 5:14296147-14296169 TAGGGAAGTTTGGACAGATCAGG + Intronic
988948405 5:36231199-36231221 TAGGGAACTTTGGCTTGAGATGG + Intronic
997397381 5:133574360-133574382 GAGGAAAGTTTTGCTGGTGCTGG - Intronic
1001163449 5:169341908-169341930 TAGGGAAGTTTCACCAGTGATGG + Intergenic
1001173896 5:169446923-169446945 TAGTGAAGTTTGGGAAATGCTGG - Intergenic
1006560607 6:34908404-34908426 TTGGTAAGGTTGGCTAGTGCTGG + Intronic
1008604704 6:53129169-53129191 TAGGGAAATTTGGCTCTTACTGG - Intronic
1014970500 6:127808934-127808956 TAGGTTAATTTGGCTAATGCAGG + Intronic
1016577384 6:145584465-145584487 TAGGGGAGTTTGGCCAGCCCTGG + Intronic
1016654497 6:146502284-146502306 AAGGAAAGTTTGGGAAGTGCTGG + Intergenic
1023119557 7:36895431-36895453 TGTGGAAGTTTGGCTGGAGCTGG + Intronic
1026314086 7:69212735-69212757 TGGGGAGGTATTGCTAGTGCAGG - Intergenic
1028513558 7:91651234-91651256 TAGGTAAGATAGGCTAGAGCTGG - Intergenic
1038393312 8:27225803-27225825 TGGGAAAGTTTGGGAAGTGCTGG - Intergenic
1040466505 8:47700497-47700519 TGGGGAAGTTTTTCCAGTGCCGG - Intronic
1043527848 8:81115607-81115629 TAGGGATGTTGGGCTAAGGCAGG + Intergenic
1045775867 8:105801872-105801894 TATGGAGGTTTGGCCAGTGTTGG - Exonic
1058459635 9:105170963-105170985 TTGTGAAGTTTGGCTGGGGCTGG + Intergenic
1059040876 9:110814256-110814278 GAAGGAAGTTTGGTTAGTGAAGG + Intergenic
1059955747 9:119514403-119514425 CAGGGAAGGTTTCCTAGTGCAGG - Intronic
1186504465 X:10080139-10080161 TAGTGACATGTGGCTAGTGCAGG + Intronic
1189460431 X:41238292-41238314 TTGAGGAGTTTGGCTAGTGCTGG - Intergenic
1190392858 X:49949354-49949376 AAGGGAATTTTGGGTAGGGCAGG + Intronic
1194400027 X:93431201-93431223 TAGGGATGTTTGTCTTGTGGAGG - Intergenic
1202266175 Y:23021480-23021502 TAGGAAAGTGTGGCCAGTGATGG - Intergenic
1202419168 Y:24655223-24655245 TAGGAAAGTGTGGCCAGTGATGG - Intergenic
1202451618 Y:25014861-25014883 TAGGAAAGTGTGGCCAGTGATGG + Intergenic