ID: 1117027515

View in Genome Browser
Species Human (GRCh38)
Location 14:51636687-51636709
Sequence TGTGGGATGTGACCCCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117027515 Original CRISPR TGTGGGATGTGACCCCTTAA AGG Intronic
900864389 1:5257446-5257468 TGTGGGGTGTGATCCCTGGATGG - Intergenic
904848090 1:33435866-33435888 TGTGGGTTGTGTCCCCCAAAAGG - Intergenic
909428023 1:75550396-75550418 CATGGGATGTGACTGCTTAATGG + Intronic
912530142 1:110314618-110314640 GGTGGGATCTGACCCTTTCATGG + Intergenic
915437531 1:155919921-155919943 TGTGGGCTGTGAGCACTGAAGGG - Intronic
917067006 1:171107724-171107746 AGTGGGATGTTACCACTGAAAGG + Exonic
922229183 1:223670934-223670956 TGTGAGATGTGATGCCTAAAAGG + Intergenic
1063932424 10:11042671-11042693 TGGGGGAGGTGACCCTTAAAGGG - Intronic
1065960805 10:30732579-30732601 AGTGGGATGTGACAGCTGAAGGG - Intergenic
1067043590 10:42971266-42971288 TGTGGGCTGGGACCCCATGAGGG - Intergenic
1067071074 10:43132459-43132481 AGTGAGATGTGCCCCCATAAAGG - Intergenic
1072402891 10:95123462-95123484 TTTGGACTGTGACCCCTTGATGG + Intergenic
1073125871 10:101148805-101148827 TGAGGGATCTGAGCCCTTGATGG + Intergenic
1074800162 10:116991695-116991717 TGTTGGAGGTGAGACCTTAATGG - Intronic
1076511932 10:131020196-131020218 TGTGGGATGTGAGCCCTGCAGGG - Intergenic
1076511939 10:131020220-131020242 TGTGGGGTGTGAGCCCTGCAAGG - Intergenic
1076511946 10:131020244-131020266 TGTGGGGTGTGAGCCCTGCAGGG - Intergenic
1076511963 10:131020292-131020314 TGTGGGGTGTGAGCCCTGGAGGG - Intergenic
1076511971 10:131020316-131020338 TGTGGGGTGTGAGCCCTGGAGGG - Intergenic
1076512132 10:131020729-131020751 TGTGGGGTGTGAGCCCTGGAGGG - Intergenic
1076512140 10:131020753-131020775 TGTGGGGTGTGAGCCCTGGAGGG - Intergenic
1078283208 11:9923709-9923731 TTTGGAATGTAACCCCTTATTGG + Intronic
1078541819 11:12218943-12218965 TGTGGGAAGTGACCGATGAATGG - Intronic
1079923891 11:26468085-26468107 TGTGGGATGTGGCTCCTTGGTGG - Intronic
1081855240 11:46299209-46299231 TGTGGGTGGTGACTCATTAATGG - Intronic
1082924196 11:58528616-58528638 TGTGGGCTGTCTCCCCTTACAGG + Intronic
1083492211 11:63021370-63021392 TGAGGGAGTTGACCCCTTTAGGG - Intergenic
1083939513 11:65888181-65888203 TCTGGGATGGAAACCCTTAAGGG - Intronic
1090599227 11:128353202-128353224 TGTAGGATGTGAGACCTAAATGG + Intergenic
1091037661 11:132248008-132248030 TGTGGGCTGTGACCATTTAATGG - Intronic
1096159952 12:49367708-49367730 AGGGGGATGTGAGCCCTTAGAGG + Intronic
1098008517 12:66024538-66024560 TGTGGGCTGAGACCACTTGAGGG + Intergenic
1099440327 12:82690798-82690820 TGTTGTATGTGATTCCTTAAAGG + Intronic
1100538860 12:95538779-95538801 TGTGTGATGAGACCCCTTTGGGG - Intronic
1101012424 12:100464807-100464829 TGTGTGATATGACCCATTAGTGG - Intergenic
1101433322 12:104644790-104644812 GTTGGGATGAGACCCCTTAGAGG + Intronic
1103560690 12:121792029-121792051 TGTGGGATGTGGGCCCTGTAGGG - Intronic
1104744203 12:131200948-131200970 TGTGGGATGAGATCACATAAGGG - Intergenic
1104790176 12:131476275-131476297 TGTGGGATGAGATCACATAAGGG + Intergenic
1106550018 13:30762940-30762962 AGTGAGATGTGACCTCCTAATGG - Intronic
1106724022 13:32466037-32466059 TGTAGGATGTGACCAATTAGAGG - Intronic
1117027515 14:51636687-51636709 TGTGGGATGTGACCCCTTAAAGG + Intronic
1121100050 14:91244384-91244406 TGCGGGTTGTGACCCATTCATGG - Exonic
1122872309 14:104644754-104644776 TGTGGGATTTTGCTCCTTAAGGG - Intergenic
1129781853 15:78277593-78277615 TCTGGGCTGTGACCACGTAAGGG - Intronic
1132161516 15:99547371-99547393 TCTGGGGTGTGAGCCCTTCAGGG + Intergenic
1134813909 16:17190139-17190161 TCTGGGAAGTGACTGCTTAATGG + Intronic
1136608165 16:31350358-31350380 TCTGGGGTGTGACTCCTTGAGGG + Intergenic
1143463099 17:7116466-7116488 TTTGAGTTGTGACCCATTAATGG - Intergenic
1144702929 17:17350634-17350656 TGGGGGATGTCACCCCTTCCAGG - Intergenic
1146721117 17:35124176-35124198 TGTGGATTGTGACCTATTAATGG + Intronic
1150604960 17:66682911-66682933 TGTGGGATGGGACCACTGATGGG + Intronic
1151047721 17:70941210-70941232 TGTGGCATGAGACCTCTAAAGGG + Intergenic
1154075482 18:11196275-11196297 TGTGGCATGTCACCTTTTAAAGG + Intergenic
1158851687 18:61501111-61501133 GGTGGGATGTGGCCCCCAAAAGG + Intronic
1164314347 19:24073720-24073742 TGTGGACTGTGTCCCCTTAGTGG - Intronic
1164531553 19:29052308-29052330 TGTGTGATGTGACCCAGTCAAGG + Intergenic
1167272420 19:48513496-48513518 GGTGGGATGTGACCCCGAGACGG - Intergenic
1168672420 19:58250701-58250723 TGTGGGATGCAACCCCAGAAAGG + Intronic
926417949 2:12668907-12668929 AGGGGGCTGTGACCCCTTGAAGG - Intergenic
927941519 2:27106093-27106115 TCTGGGCTGTGACCCTTTGACGG - Intronic
928236783 2:29548955-29548977 TGTGGTTTGTAACCCATTAATGG + Intronic
930362129 2:50394537-50394559 TGTGGGATTTTACCACTTATTGG + Intronic
940484701 2:154282772-154282794 TCTGGCAGGTGACCACTTAAAGG + Intronic
1170134975 20:13062706-13062728 TGTATGATGTGATCCCATAAAGG - Intronic
1182504595 22:30772743-30772765 TGTGGTATGTGACACCTCACAGG - Intronic
1183760045 22:39807716-39807738 TGTGGGTTGTGACCAATTAGTGG + Intronic
1185412748 22:50694591-50694613 ACTGGGATGTGGCCCCTTAATGG + Intergenic
950961952 3:17116859-17116881 TGTTGCCTGTGACACCTTAATGG - Intergenic
954115937 3:48466801-48466823 TGTGGGAGGTGGCCCCTGAGAGG - Exonic
954129129 3:48550878-48550900 TGTGGTATCTGAGCCCTTTAGGG + Intronic
954422114 3:50424295-50424317 TGTGGGATGTGGTCCCTGGATGG + Intronic
954492871 3:50923791-50923813 TGTGGTATTTGAGCCCTTGATGG + Intronic
956068223 3:65419451-65419473 TGTGGGCTGTGACCTATTACTGG - Intronic
959157870 3:102688447-102688469 TGTGGGATTTTATCCCTTAGGGG - Intergenic
962369095 3:134805875-134805897 TGTGGAATGTGATCCCATAGAGG - Intronic
963547612 3:146680633-146680655 AGTGGGATGAGACCACTCAAAGG - Intergenic
971147424 4:23994225-23994247 TGTAGGAAGTAACCCGTTAAAGG + Intergenic
976097221 4:81521711-81521733 AGTGGAATGTGACCTCTTGAGGG + Intronic
979926496 4:126572517-126572539 TCTGTGATGTGACCCCTTCCTGG + Intergenic
981549072 4:145924579-145924601 CGGTGGATGTGACCCCTGAAGGG - Intronic
984564672 4:181313829-181313851 TGTGGGTTGTGACCCAGTAGTGG + Intergenic
984662847 4:182392161-182392183 TGTGGGATGTGAACAGTGAAGGG + Intronic
989691238 5:44146913-44146935 TGTGGGATTAGTGCCCTTAAAGG + Intergenic
992415395 5:76547875-76547897 TGTGGGATGTGACACCCTGCAGG - Intronic
998472838 5:142396739-142396761 TGTGGGAGGTGACCAATTAGAGG + Intergenic
1004042005 6:11988523-11988545 TGTGGAATGTGCCCCCTCCAAGG - Intergenic
1004683666 6:17920951-17920973 TGGAGGATATGACCCTTTAAGGG - Intronic
1011774538 6:90714724-90714746 TGTCGGATGTCACCACTGAAGGG - Intergenic
1022439953 7:30425061-30425083 TGTGGGATTTGACTCCTCCAAGG - Exonic
1024371629 7:48590862-48590884 TATAGGATGTAACCCCTTATTGG + Intronic
1027219470 7:76204726-76204748 GGTGGGAAGGGACCCCTTCAAGG - Intronic
1033277397 7:139982727-139982749 TGTGGGCTGTGATCCTTTAGGGG - Intronic
1039137799 8:34346192-34346214 TGTGGGATATGATCACATAATGG - Intergenic
1046777737 8:118181510-118181532 TGTAGCATGTGACCCCAAAATGG + Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1056815026 9:89795005-89795027 TTTGGGATGTGACCCCGAAAAGG + Intergenic
1056963406 9:91146364-91146386 TGTGGATTGGGACCCCTTAATGG - Intergenic
1058894032 9:109384354-109384376 TGTGGGATATCACCTCTTTAGGG - Intronic
1062251453 9:135597700-135597722 TGTGGGTTGTGCCCCATTTATGG + Intergenic
1189912450 X:45824727-45824749 GGTGGGCTGTGAGCCCTTCATGG - Intergenic
1201409182 Y:13681211-13681233 TCTGGCATGTGCCCCCTTCAGGG + Intergenic
1201713700 Y:17020129-17020151 TGTGGGAAGTGACTACTTAATGG - Intergenic