ID: 1117038287

View in Genome Browser
Species Human (GRCh38)
Location 14:51748602-51748624
Sequence GCTCATTGACGACCCAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117038273_1117038287 4 Left 1117038273 14:51748575-51748597 CCATTCCACCCCACCCCTCCCCC No data
Right 1117038287 14:51748602-51748624 GCTCATTGACGACCCAAAACGGG No data
1117038275_1117038287 -1 Left 1117038275 14:51748580-51748602 CCACCCCACCCCTCCCCCGGCAG No data
Right 1117038287 14:51748602-51748624 GCTCATTGACGACCCAAAACGGG No data
1117038278_1117038287 -6 Left 1117038278 14:51748585-51748607 CCACCCCTCCCCCGGCAGCTCAT No data
Right 1117038287 14:51748602-51748624 GCTCATTGACGACCCAAAACGGG No data
1117038280_1117038287 -10 Left 1117038280 14:51748589-51748611 CCCTCCCCCGGCAGCTCATTGAC No data
Right 1117038287 14:51748602-51748624 GCTCATTGACGACCCAAAACGGG No data
1117038277_1117038287 -5 Left 1117038277 14:51748584-51748606 CCCACCCCTCCCCCGGCAGCTCA No data
Right 1117038287 14:51748602-51748624 GCTCATTGACGACCCAAAACGGG No data
1117038276_1117038287 -4 Left 1117038276 14:51748583-51748605 CCCCACCCCTCCCCCGGCAGCTC No data
Right 1117038287 14:51748602-51748624 GCTCATTGACGACCCAAAACGGG No data
1117038279_1117038287 -9 Left 1117038279 14:51748588-51748610 CCCCTCCCCCGGCAGCTCATTGA No data
Right 1117038287 14:51748602-51748624 GCTCATTGACGACCCAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117038287 Original CRISPR GCTCATTGACGACCCAAAAC GGG Intergenic
No off target data available for this crispr