ID: 1117038787

View in Genome Browser
Species Human (GRCh38)
Location 14:51751642-51751664
Sequence ATGCACTTGAAGGCTTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117038787_1117038794 17 Left 1117038787 14:51751642-51751664 CCTTTTTAAGCCTTCAAGTGCAT No data
Right 1117038794 14:51751682-51751704 AAAGGGCCTATCGAACTCTGGGG No data
1117038787_1117038795 18 Left 1117038787 14:51751642-51751664 CCTTTTTAAGCCTTCAAGTGCAT No data
Right 1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG No data
1117038787_1117038797 24 Left 1117038787 14:51751642-51751664 CCTTTTTAAGCCTTCAAGTGCAT No data
Right 1117038797 14:51751689-51751711 CTATCGAACTCTGGGGGAAAAGG No data
1117038787_1117038792 15 Left 1117038787 14:51751642-51751664 CCTTTTTAAGCCTTCAAGTGCAT No data
Right 1117038792 14:51751680-51751702 GAAAAGGGCCTATCGAACTCTGG No data
1117038787_1117038793 16 Left 1117038787 14:51751642-51751664 CCTTTTTAAGCCTTCAAGTGCAT No data
Right 1117038793 14:51751681-51751703 AAAAGGGCCTATCGAACTCTGGG No data
1117038787_1117038791 0 Left 1117038787 14:51751642-51751664 CCTTTTTAAGCCTTCAAGTGCAT No data
Right 1117038791 14:51751665-51751687 GGAGTGTGACAGAAAGAAAAGGG No data
1117038787_1117038790 -1 Left 1117038787 14:51751642-51751664 CCTTTTTAAGCCTTCAAGTGCAT No data
Right 1117038790 14:51751664-51751686 TGGAGTGTGACAGAAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117038787 Original CRISPR ATGCACTTGAAGGCTTAAAA AGG (reversed) Intergenic
No off target data available for this crispr