ID: 1117038795

View in Genome Browser
Species Human (GRCh38)
Location 14:51751683-51751705
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117038789_1117038795 8 Left 1117038789 14:51751652-51751674 CCTTCAAGTGCATGGAGTGTGAC No data
Right 1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG No data
1117038787_1117038795 18 Left 1117038787 14:51751642-51751664 CCTTTTTAAGCCTTCAAGTGCAT No data
Right 1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117038795 Original CRISPR AAGGGCCTATCGAACTCTGG GGG Intergenic
No off target data available for this crispr