ID: 1117039181

View in Genome Browser
Species Human (GRCh38)
Location 14:51753990-51754012
Sequence GTGCACACACCCTGCGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117039176_1117039181 8 Left 1117039176 14:51753959-51753981 CCTGGATGTTAGCAACGAGATCA No data
Right 1117039181 14:51753990-51754012 GTGCACACACCCTGCGATATTGG No data
1117039175_1117039181 13 Left 1117039175 14:51753954-51753976 CCAAACCTGGATGTTAGCAACGA No data
Right 1117039181 14:51753990-51754012 GTGCACACACCCTGCGATATTGG No data
1117039172_1117039181 18 Left 1117039172 14:51753949-51753971 CCTCCCCAAACCTGGATGTTAGC No data
Right 1117039181 14:51753990-51754012 GTGCACACACCCTGCGATATTGG No data
1117039173_1117039181 15 Left 1117039173 14:51753952-51753974 CCCCAAACCTGGATGTTAGCAAC No data
Right 1117039181 14:51753990-51754012 GTGCACACACCCTGCGATATTGG No data
1117039174_1117039181 14 Left 1117039174 14:51753953-51753975 CCCAAACCTGGATGTTAGCAACG No data
Right 1117039181 14:51753990-51754012 GTGCACACACCCTGCGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117039181 Original CRISPR GTGCACACACCCTGCGATAT TGG Intergenic
No off target data available for this crispr