ID: 1117039773

View in Genome Browser
Species Human (GRCh38)
Location 14:51759325-51759347
Sequence CTAATGTTTTTAAAATGTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1117039773_1117039774 12 Left 1117039773 14:51759325-51759347 CCGAGACATTTTAAAAACATTAG No data
Right 1117039774 14:51759360-51759382 TTGTTTCGATTAAGAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1117039773 Original CRISPR CTAATGTTTTTAAAATGTCT CGG (reversed) Intergenic
No off target data available for this crispr